ID: 1031529317

View in Genome Browser
Species Human (GRCh38)
Location 7:122856994-122857016
Sequence CCTTATGGGGAGAGGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 444}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031529317_1031529326 26 Left 1031529317 7:122856994-122857016 CCAGCCCTCCTCTCCCCATAAGG 0: 1
1: 0
2: 2
3: 40
4: 444
Right 1031529326 7:122857043-122857065 AATTATGATTTGTATGTATGAGG 0: 1
1: 0
2: 2
3: 42
4: 568
1031529317_1031529325 -1 Left 1031529317 7:122856994-122857016 CCAGCCCTCCTCTCCCCATAAGG 0: 1
1: 0
2: 2
3: 40
4: 444
Right 1031529325 7:122857016-122857038 GTTTTTGCAGATATTCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031529317 Original CRISPR CCTTATGGGGAGAGGAGGGC TGG (reversed) Intronic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
900406780 1:2496252-2496274 CGCTATGTGGAGAGGAGGCCAGG - Intronic
900526832 1:3133477-3133499 CACGATGGGGAGAGGAGGGCAGG + Intronic
900717232 1:4152922-4152944 TCTTGTTGGGAAAGGAGGGCTGG + Intergenic
900790269 1:4675376-4675398 CCTCAATGGGAGAGGATGGCCGG - Intronic
900910416 1:5593446-5593468 GCTTATGGGGAGACGAAGGTGGG - Intergenic
902391281 1:16108513-16108535 CCTTATGGGAAAAGAAGGGATGG + Intergenic
902609095 1:17586807-17586829 CTTTAATGGGAGAGGAGGACAGG + Intronic
904029341 1:27524119-27524141 CCTCATGGGAAAAGGAGGGAGGG + Intergenic
904333760 1:29784242-29784264 GCTGATGGGGGGAGCAGGGCTGG - Intergenic
904362417 1:29985034-29985056 TCTAATGAGGAGAGAAGGGCAGG - Intergenic
904816610 1:33207098-33207120 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
905658855 1:39704869-39704891 ACTTATGGGGAGGGGAGGTGGGG - Intronic
905898807 1:41567135-41567157 CTTTATGGGGTGAGAAGGGATGG - Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906677432 1:47703183-47703205 ATTTATGGGGACAGGAGGGAGGG - Intergenic
907564826 1:55425061-55425083 CCTTATGGGAAAAGGAAGGAAGG - Intergenic
907865003 1:58390947-58390969 ACATATGGGGAGAGGAAGGGAGG - Intronic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
912588142 1:110785809-110785831 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
913259588 1:116986193-116986215 ACTTATGGGGAAAGGAAGGTGGG + Intronic
913646431 1:120860021-120860043 GCTTAAAGGGAAAGGAGGGCTGG + Intergenic
914080218 1:144402850-144402872 GCTTAAAGGGAAAGGAGGGCTGG - Intergenic
914175124 1:145271382-145271404 GCTTAAAGGGAAAGGAGGGCTGG - Intergenic
914340228 1:146753969-146753991 CCTTATGAGGAGAGGAGATTAGG - Intergenic
914529848 1:148512862-148512884 GCTTAAAGGGAAAGGAGGGCTGG - Intergenic
914831422 1:151173615-151173637 CCTGATGGGGAGATGAAGGATGG + Exonic
915524517 1:156467720-156467742 CCCTATGGGGAGAGGGGAGTGGG - Intronic
915529356 1:156494475-156494497 CTGGATGGGGAGGGGAGGGCTGG + Intronic
915725584 1:158014675-158014697 CTTTATGGGGGGGGGGGGGCGGG + Intronic
915955174 1:160214856-160214878 CTTTAATGGGAGGGGAGGGCTGG + Exonic
915977601 1:160401006-160401028 GCTTATGGGGGAAGGGGGGCTGG + Intronic
916143809 1:161722761-161722783 AGGTATGGGGAGAGGAGGGTGGG + Intronic
916753496 1:167745021-167745043 CTTTTTGGGGAGAGCAGGGCAGG + Intronic
917799136 1:178554287-178554309 CCTTATGGGAAAAGAAGGGATGG + Intergenic
918175522 1:182040970-182040992 CATTGTGGGGTGAGTAGGGCAGG + Intergenic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
919408881 1:197218962-197218984 CTTGATGGGGAGAGGAGGACAGG + Intergenic
919775220 1:201190114-201190136 TCTTAAGGAGAGTGGAGGGCAGG - Intergenic
920312525 1:205057034-205057056 CCTTATGGTGGGTGGAGGGTGGG - Intronic
921566812 1:216731356-216731378 TCTTATGGGGAGAGGAAGAAGGG + Intronic
922160288 1:223074633-223074655 CTTTGTGGGGAGAGGAGGCAGGG + Intergenic
922740286 1:228010580-228010602 CCTGAGAGGGAGAGCAGGGCTGG - Intronic
922934335 1:229411770-229411792 CCTAGTGGGGAGACGGGGGCAGG - Intergenic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
1063369429 10:5511605-5511627 CCTGATGGTGAGAGACGGGCGGG - Intergenic
1063464929 10:6236912-6236934 GCTGTCGGGGAGAGGAGGGCTGG + Intergenic
1066335409 10:34472495-34472517 CAAAATGGGGAGAGGTGGGCAGG + Intronic
1069162307 10:65107073-65107095 CCTTATGGGAAGCGAAGGGATGG - Intergenic
1069466735 10:68646629-68646651 GGTTAGGTGGAGAGGAGGGCTGG - Exonic
1070446956 10:76514490-76514512 CTTTCTGGAGAGAGCAGGGCAGG + Intronic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1072314542 10:94189406-94189428 TCTTGTGGGGAGAGGAGGGAAGG - Intronic
1072905857 10:99453006-99453028 CCTTAGAGGGAGAGAAGAGCTGG - Intergenic
1073035761 10:100563135-100563157 CCTGATGGGGGCAGGAGGACGGG + Intergenic
1073454778 10:103629869-103629891 CCCCCTGGGGAGAGGAGGGGAGG + Intronic
1073593730 10:104780010-104780032 GCTTATGGGGAGGGGAAGGGAGG + Intronic
1074247782 10:111712681-111712703 CATAATGGAGAGAGGAAGGCAGG + Intergenic
1074391585 10:113062585-113062607 CCTTTTGGGGATAGGGTGGCAGG + Intronic
1075670994 10:124264071-124264093 TCTTAGGGGGAGAGCAGGACAGG - Intergenic
1075777282 10:124997037-124997059 GCTTGTGGGGAGAGGAGCACGGG + Intronic
1076169856 10:128309944-128309966 CCACCTGGGGACAGGAGGGCAGG + Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076481456 10:130787829-130787851 CCTTCAGGGGGGAGGTGGGCAGG - Intergenic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1077797237 11:5505452-5505474 CCTAATGGGGAGTGGAGTGAGGG + Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1080711605 11:34753116-34753138 CCTTATGAGGAGAAGATTGCAGG + Intergenic
1080888509 11:36388373-36388395 CCTTTTGGGGAAAGGAGGTTAGG + Intronic
1081354927 11:42101049-42101071 CCTTTTGGAGAGTGGAGGGTAGG - Intergenic
1081534397 11:43986700-43986722 CCTTTGGTGGAGAGAAGGGCTGG - Intergenic
1081616280 11:44593293-44593315 CCTTATGGAGGGGGAAGGGCAGG - Intronic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1082918412 11:58464829-58464851 CCTTATGGGGTGAGGTTGGAGGG + Intergenic
1083015762 11:59452273-59452295 CCTTTTGGAGAGTGGAGGGTGGG - Intergenic
1083418838 11:62542425-62542447 GGTGATGGGGAGGGGAGGGCTGG - Intronic
1084096371 11:66914169-66914191 CCTTATGGAGAGAGAGGGGCAGG - Intronic
1084739484 11:71130034-71130056 CCTTATGAGAAGAGGAGGTGAGG - Intronic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085614608 11:77986830-77986852 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1086251657 11:84822689-84822711 TCTTATGGAGAGAGAAGGACTGG + Intronic
1088370611 11:109084539-109084561 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089505307 11:118958350-118958372 GCTCTAGGGGAGAGGAGGGCAGG - Exonic
1089787982 11:120921725-120921747 CCCCATGGAGAGAGGAGGGAGGG - Intronic
1090120165 11:124018349-124018371 CCTTTTGGGGGGTGGGGGGCTGG - Intergenic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1091046135 11:132327590-132327612 TCTAGTGGGCAGAGGAGGGCTGG - Intronic
1091209120 11:133841875-133841897 CAGTAGTGGGAGAGGAGGGCTGG - Intronic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1091744745 12:2983911-2983933 CCTTACTGGGAGATGGGGGCTGG + Intronic
1091801286 12:3326311-3326333 CCAACTGGGAAGAGGAGGGCAGG - Intergenic
1092285315 12:7125255-7125277 CCTTTAGGGGAGAGCAGGGGTGG + Intronic
1093597138 12:20975739-20975761 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1095954393 12:47798070-47798092 GCATGTGGGGACAGGAGGGCAGG + Intronic
1095973989 12:47926847-47926869 CCCTCTGTGGAGAGGAGAGCTGG - Intronic
1096043528 12:48541856-48541878 CCTTATAGAGAGAGGACAGCTGG + Intergenic
1096450240 12:51734412-51734434 CCTTATGGGAAAAGAAGGGAAGG + Intronic
1097820153 12:64120498-64120520 CCTTAATGGGGGTGGAGGGCAGG + Intronic
1098685094 12:73409866-73409888 CCTTTTGGGGGGTGAAGGGCTGG - Intergenic
1100297448 12:93275867-93275889 ACTGATGGGGAGAGGTGGGGAGG + Intergenic
1100368915 12:93947218-93947240 CATAAGGGGGAGAGGAGGGATGG - Intergenic
1100472510 12:94905995-94906017 CCTTATGGGAAGTGAAGGGATGG - Intronic
1100574000 12:95872110-95872132 CTATATGAGGAGAGCAGGGCTGG + Intronic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102337341 12:112092970-112092992 CCTTAAAGAGAAAGGAGGGCCGG - Intronic
1102609511 12:114099179-114099201 CCTCATGGGAGGGGGAGGGCAGG + Intergenic
1103083468 12:118043454-118043476 ACTTTTGGGGAGTGGAGGGAAGG + Intronic
1104287600 12:127439284-127439306 TGTTGTGGGGAGAAGAGGGCTGG - Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104933281 12:132351667-132351689 CCCTCTGGGGACAGGAGGGATGG + Intergenic
1105293662 13:19070757-19070779 CCTTAGGAGGGGAGGAGTGCAGG - Intergenic
1105664544 13:22538046-22538068 CGTGATGTGGAGAGGAGGGTGGG + Intergenic
1107668302 13:42715986-42716008 CTTTCTGGGGACAGCAGGGCAGG + Intergenic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1109273450 13:60279532-60279554 CACAATGGGGAGAGGAGGACAGG - Intergenic
1111389576 13:87575318-87575340 GCTTATGGGGATAGAAGGGAAGG - Intergenic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113076649 13:106473581-106473603 CCTGATGGGGAGACGGGGTCTGG - Intergenic
1113672367 13:112183735-112183757 CCTTATAGGAAGAGGAGGTTAGG - Intergenic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114873059 14:26681287-26681309 CCTTTTGGAGAGTGGAGGGTGGG - Intergenic
1115958685 14:38810346-38810368 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1116464790 14:45219076-45219098 CTTTATGGGGAGAGTGGGGGTGG - Intronic
1117289589 14:54319731-54319753 TTTTATGGGGAGTGGAGGGGAGG - Intergenic
1117803296 14:59465655-59465677 CCTTTTGGGGAGTGGTGGGGGGG + Intronic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1117920884 14:60724162-60724184 CCGGAGGGGGAGAGGAGGGAGGG - Intronic
1118365228 14:65089365-65089387 CCTTATGGGGAGAGCTGTGTTGG - Intronic
1119720662 14:76888102-76888124 CCTGATGGGAAGGTGAGGGCAGG + Intergenic
1120255186 14:82109916-82109938 CTTTCGGGGGAGAGCAGGGCAGG + Intergenic
1121235206 14:92387067-92387089 TCTTTAGGGGAGTGGAGGGCTGG - Intronic
1122397533 14:101444166-101444188 CCATGTGGGTAGAGGAAGGCGGG - Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123019495 14:105391049-105391071 ACAGATGGGGAGAGAAGGGCAGG + Intronic
1124388635 15:29232176-29232198 CCTTATGGGGCCAGGAGCGGTGG - Intronic
1124505338 15:30267671-30267693 CCTGGTGGGGGCAGGAGGGCTGG + Intergenic
1124738214 15:32270960-32270982 CCTGGTGGGGGCAGGAGGGCTGG - Intergenic
1124898680 15:33801703-33801725 CATTATGGGAAGAGGGGGTCAGG - Intronic
1125786410 15:42322390-42322412 CTTTCTGGGGAGAGCAGGGGTGG + Intronic
1126839704 15:52705348-52705370 CCTGTTGGGGAGTGGGGGGCTGG + Intronic
1127309435 15:57739322-57739344 CCTGTTGGGGGGAGGGGGGCAGG + Intronic
1127381941 15:58438159-58438181 GCTGATGTGGAGAGGAGGGCAGG - Intronic
1127964184 15:63911760-63911782 CCTTCAGGGAAGAGGAGGACTGG + Intronic
1129897232 15:79117542-79117564 CCTTTTGGGCAGTGGAGTGCAGG - Intergenic
1131065034 15:89429279-89429301 CCTCCTGGGGAGAGGAGTGGAGG - Intergenic
1131431851 15:92394327-92394349 CGGTTTGGGGAGAGGAGGGTGGG + Intronic
1131714812 15:95096853-95096875 CCGTCCGCGGAGAGGAGGGCTGG - Intergenic
1132293984 15:100721573-100721595 GCTGCTGGGGAAAGGAGGGCGGG + Intergenic
1132684290 16:1155836-1155858 CTCCAGGGGGAGAGGAGGGCTGG + Intronic
1132834290 16:1944980-1945002 CCTTAGGGGGGCAGTAGGGCCGG - Intronic
1133025924 16:2988918-2988940 CCGGAGGGGGAGAGGAGGGAGGG + Intergenic
1133027631 16:2995598-2995620 GACTATGGGGAGAGGAGGGTGGG - Intergenic
1133269470 16:4603535-4603557 TCATGTGGGGAGAGGAGGGAGGG + Intergenic
1133361349 16:5176352-5176374 CCTTATAGGAAGAGGAGAGTAGG + Intergenic
1134356088 16:13483611-13483633 GATTAGAGGGAGAGGAGGGCTGG - Intergenic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135137378 16:19895116-19895138 AATGGTGGGGAGAGGAGGGCAGG + Intergenic
1135969774 16:27063758-27063780 CCTCATGGGGAGCATAGGGCTGG + Intergenic
1136730692 16:32409265-32409287 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
1137476739 16:48815881-48815903 CCTATTGGGGAGTGGAGGGTGGG + Intergenic
1137537758 16:49340340-49340362 TCTTATGGGGAGAGGCAGGTTGG - Intergenic
1138431546 16:56972234-56972256 CCTGATGCTGCGAGGAGGGCAGG + Intronic
1139384273 16:66554554-66554576 CATTATTGGGATGGGAGGGCAGG + Intronic
1139994060 16:70963439-70963461 CCTTATGAGGAGAGGAGATTAGG + Intronic
1140067297 16:71622353-71622375 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
1140732947 16:77872623-77872645 CCTTATGGTGGGAGGAAGACTGG - Intronic
1141026459 16:80553514-80553536 GCTTATGGGGAATGGGGGGCAGG - Intergenic
1141153321 16:81579612-81579634 CCTTCAGGGGGGAGCAGGGCTGG - Intronic
1141227985 16:82137339-82137361 CATGATCGGGAGAGGAGGGAGGG + Intergenic
1141374155 16:83514345-83514367 CCTCATAAGAAGAGGAGGGCCGG + Intronic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141702551 16:85649133-85649155 CCTTATGAGAAGAGGAGATCAGG - Intronic
1141771726 16:86093808-86093830 CCATTTGGGGAGAGGAGAGAGGG - Intergenic
1141946709 16:87315704-87315726 CCCTGTGGGGTGAGGAGAGCAGG - Intronic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1202995705 16_KI270728v1_random:108004-108026 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1203022392 16_KI270728v1_random:420346-420368 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142865982 17:2791803-2791825 CTTGATGGGGCCAGGAGGGCTGG + Intronic
1142954512 17:3512334-3512356 CCGATTGGGGAGAGGTGGGCTGG - Intronic
1143515333 17:7416905-7416927 CCCTGTGGGCACAGGAGGGCAGG - Exonic
1143584363 17:7844034-7844056 CCTGAGGGAGGGAGGAGGGCGGG - Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144642252 17:16944009-16944031 CTTGGTGGGGAGAGGAGGGCAGG - Intronic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1147188646 17:38726228-38726250 CGTGATGGGGAGGAGAGGGCAGG + Exonic
1147465760 17:40609415-40609437 CCTTATAGGAAGAGGAGATCGGG - Intergenic
1147972594 17:44227640-44227662 CCTTTCTGGGAGAGGAGGGGTGG - Intergenic
1148109852 17:45138173-45138195 CCCTTTGGGGAGAGGAGGGAGGG - Intronic
1148847630 17:50538540-50538562 CCTTTTGGGGAGACAAGGACAGG + Intronic
1148866047 17:50629244-50629266 CCTACTGGGAAGAGGAGGCCAGG - Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149219946 17:54405421-54405443 CCTAATGAGGAAAGTAGGGCAGG + Intergenic
1149331673 17:55589076-55589098 ACATTTGGGGAAAGGAGGGCTGG - Intergenic
1149335439 17:55630750-55630772 GCTTAAGGGGAGATGAGGGAAGG - Intergenic
1150277424 17:63908862-63908884 CCTGATGGTGACAGGCGGGCTGG + Intergenic
1150625488 17:66838472-66838494 CCTTGTGGGGAGGAGAAGGCTGG + Intronic
1150941285 17:69697210-69697232 CCTTGTGGTGGGAGAAGGGCAGG + Intergenic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1152010206 17:77708359-77708381 CCTTATAAGGAGAGGAGATCTGG - Intergenic
1152213938 17:79021314-79021336 CCTCTTGGGAAGAGGAGGGAAGG - Intergenic
1152361693 17:79835890-79835912 CCTCTTGGGCAGAGGAGGGTTGG - Intronic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1152568588 17:81111381-81111403 CCTTGTGGGGACTGGAGGTCAGG + Intronic
1152585219 17:81186246-81186268 CCCTGTGGGGAGTGGAGTGCGGG - Intergenic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1155100800 18:22608038-22608060 CAAAATGGGGAGAGCAGGGCAGG - Intergenic
1155389116 18:25315036-25315058 CCTCAGGGGGTGGGGAGGGCTGG - Intronic
1156753248 18:40486832-40486854 CCTTATGGGGACATGGGGGCAGG + Intergenic
1157308179 18:46532065-46532087 CCTTATGGAGACAGGAAGACAGG - Intronic
1157913458 18:51641016-51641038 CCTTGGGGGGGCAGGAGGGCAGG - Intergenic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158677143 18:59530221-59530243 CCCCATGGGGAGAGGAAGTCTGG + Intronic
1160001211 18:75025591-75025613 CCTTTTGGGGAGAGGTGGTGGGG - Intronic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161118354 19:2511882-2511904 CTTCCTGGAGAGAGGAGGGCAGG + Exonic
1161256880 19:3314705-3314727 CCTTATGGGGACCGGAGTGCGGG - Intergenic
1161724001 19:5918118-5918140 CCTTTCGGGGAGAGGCCGGCAGG - Intronic
1162735492 19:12744931-12744953 CCTTAAGGAGAAAGGAAGGCAGG + Intronic
1162853274 19:13448342-13448364 CCTTTTGGAGGGTGGAGGGCGGG + Intronic
1162955865 19:14097544-14097566 CCTCAGGGGAAGGGGAGGGCTGG + Intronic
1164031627 19:21412227-21412249 CCTTATGGGAAATGGAGGGATGG + Intronic
1165240598 19:34463761-34463783 CCTTATAGGAGGAGGAAGGCAGG - Intronic
1165300910 19:34968192-34968214 CCTCATGGGGAGGGGAGCACAGG - Intergenic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1166119552 19:40677420-40677442 CCCTATGGGGAGAGGATGGGCGG + Exonic
1167447362 19:49545608-49545630 TCTTATCGGGAGAGGGAGGCTGG + Intronic
1167476053 19:49701475-49701497 ACTAAAGGGGAGAAGAGGGCAGG - Exonic
1167564027 19:50244913-50244935 CCCTGTGGGGAGAGGGGGTCTGG - Intronic
1167602367 19:50461770-50461792 CCCAGTGGGGAGGGGAGGGCAGG - Intronic
1167715512 19:51140602-51140624 CCTTATGGGGAGAGAGTGGCTGG + Intergenic
1168320971 19:55509204-55509226 TCTTATGGGGAGAGGGTGGCTGG - Intronic
1168651999 19:58097684-58097706 CCTGAAGGGAAGAGGAGGGGAGG - Intronic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
925373226 2:3362385-3362407 CCGAATGGGGAGAGGAGGGTGGG - Intronic
925965277 2:9059931-9059953 CTTTCTGGGAAGAGCAGGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927119367 2:19940847-19940869 CTTTTAGGGGAGAGAAGGGCAGG - Intronic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927982031 2:27380434-27380456 CCTTGAGGGGAGAGGAGCGGGGG - Intronic
928283598 2:29970024-29970046 CTTTCTGGAGAGAGCAGGGCAGG - Intergenic
928421385 2:31139683-31139705 CTTTATGGGGAGAGAGGGGCAGG - Intronic
928449048 2:31362125-31362147 CCTTTTGGGGTGAGTAGAGCAGG + Intronic
928905869 2:36366908-36366930 CCTTATGGTGTGAGGAGTGTGGG + Intronic
929869356 2:45745255-45745277 CCTGGTGGGGAGAGGAGGCCCGG + Intronic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930826798 2:55703377-55703399 CTTTTTGGGGAGAGCAGGACAGG + Intergenic
934315027 2:91909984-91910006 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
934975796 2:98801240-98801262 CCTCATTGGCAGAGGAGTGCAGG + Intronic
935210877 2:100938589-100938611 GCTTATGCAGAGAGGAGGGAGGG - Intronic
935264352 2:101381906-101381928 CCTCATGGGGAGAGGATTTCAGG - Intronic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936386253 2:112032279-112032301 CCATATGGTCAGAGGTGGGCTGG + Intergenic
937047894 2:118861862-118861884 TTTTATGGGGAGAGGATGGTGGG - Intergenic
937309801 2:120895047-120895069 GCTGATGGGGAGGGGAGGGGAGG + Intronic
938122240 2:128642085-128642107 TCATATGGCGAGAGGAGGGGAGG + Intergenic
938237937 2:129721929-129721951 CTTTCTGGGGTGAGGTGGGCGGG + Intergenic
938384391 2:130854015-130854037 CCCTATGAGGTGAGCAGGGCAGG - Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
939423111 2:141999236-141999258 CATGATGGGGAGGGGAGGGTCGG - Intronic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
940673852 2:156704856-156704878 CTCTCTGGGGAGAGCAGGGCTGG - Intergenic
942493658 2:176516214-176516236 CTTTCTTGGGAGAGCAGGGCAGG + Intergenic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
944677750 2:202048357-202048379 CCTTATGGGAAGAGGAAGAGAGG + Intergenic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945113628 2:206389367-206389389 CTTTCTGGGAAGAGTAGGGCAGG + Intergenic
945292315 2:208138404-208138426 CCTTATGGGAAAAGAAGGGATGG + Intergenic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
947516659 2:230811327-230811349 TCTTACTGGGAGTGGAGGGCAGG - Intronic
947529421 2:230899285-230899307 CCTTATGGGGAGATGGGAGAGGG - Intergenic
947845900 2:233243563-233243585 CCTGGTGGGGAGAATAGGGCTGG + Intronic
948373457 2:237505180-237505202 CCTGATGCAGAGTGGAGGGCAGG + Intronic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948723438 2:239918021-239918043 CCAGGTGGGGAGAGGAGGCCTGG + Intronic
948944648 2:241213311-241213333 GCTGATGGGGAGAGGACAGCTGG - Intronic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169078965 20:2782998-2783020 CCTTATAAGAAGAGGAGGTCGGG - Intergenic
1170917514 20:20642041-20642063 CCTGCTTGGGAGAGGAGGACAGG - Intronic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1172104748 20:32510280-32510302 CAGTGTGGGGACAGGAGGGCTGG + Intronic
1172219973 20:33267243-33267265 CCTTATGAGAAGAGGAGGTTAGG - Intergenic
1172591680 20:36122310-36122332 CCAAATGGGGACAGGAGGCCTGG + Intronic
1172646610 20:36474275-36474297 TCTTATGGGGAAAGGTGGCCTGG + Intronic
1172871906 20:38141385-38141407 CCTGAGGGGGATAGGGGGGCGGG + Exonic
1173226130 20:41163356-41163378 CCTGATGGGGTAGGGAGGGCAGG - Exonic
1173459806 20:43234002-43234024 CCTTATGGGAAGAGGAGATTTGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174110743 20:48196150-48196172 CCATATGGAGAGAGGGGGGGTGG + Intergenic
1174317365 20:49713392-49713414 CCTGTTGGGGTGCGGAGGGCAGG + Intronic
1174406922 20:50308856-50308878 CCGTCTGGGAAGAGGAGGCCGGG - Intergenic
1174443416 20:50574347-50574369 CCTCATGGGGAGATGGGGGTGGG - Intronic
1175591936 20:60200321-60200343 CCCTATTGGGTGAGGAGGGATGG + Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1176031898 20:63016877-63016899 CCTTATGGGGACATGAGTGGGGG + Intergenic
1176067528 20:63206134-63206156 GCTAATGGGAGGAGGAGGGCTGG - Intronic
1176166990 20:63679548-63679570 CCAGGTGGGGAGAGGAGGCCTGG - Intronic
1176676044 21:9778488-9778510 TATTATGGGGAAAGAAGGGCTGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1179637279 21:42721185-42721207 CCTAAGGAAGAGAGGAGGGCAGG + Intronic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181636639 22:24177761-24177783 CCTTTGGGGGAGAGCAGGGTTGG - Exonic
1182491505 22:30675287-30675309 GGTTATGGGCAGAGGTGGGCAGG - Intergenic
1183427273 22:37746522-37746544 CCCGAAGGCGAGAGGAGGGCTGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184985141 22:48127196-48127218 CCTTTTGGGGGGTGGGGGGCAGG - Intergenic
1185169308 22:49283167-49283189 CCTGGTGGGCAGAGGAGGCCAGG + Intergenic
1185279686 22:49964749-49964771 CCTGGTGGGTAGAGGAGGCCTGG + Intergenic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
951699491 3:25480734-25480756 CTTTATTGGGAGGGCAGGGCAGG + Intronic
952740038 3:36725963-36725985 CCTTGTTGGGGGAGGAGGACAGG - Intronic
952967744 3:38631631-38631653 GCTTATGGGGAGAGGATGAGTGG - Intronic
953080741 3:39615146-39615168 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
954364276 3:50137977-50137999 TGTGATGGGGAGAGGAGGGAGGG + Intergenic
954952048 3:54484064-54484086 CCTTATGGGGTGAGATGGGTAGG + Intronic
955285352 3:57635500-57635522 CCTTATGCAGAGAAGAGGGAGGG - Intronic
955353970 3:58215287-58215309 CCTGATGGGGTCAGGAGGCCAGG - Intergenic
955769158 3:62372163-62372185 CCTTATGGGGATAGGGAGCCGGG + Exonic
956003928 3:64759355-64759377 CCTTATTGGGAGATTAGGGATGG - Intergenic
956611698 3:71130344-71130366 TCTGATGGAGAGAGGAGGGAAGG + Intronic
956923363 3:73954502-73954524 CCTTTTGGCAAAAGGAGGGCAGG - Intergenic
957824534 3:85423278-85423300 CATTATGGGCAGGGGAGGGGTGG + Intronic
959041553 3:101427844-101427866 CCTGTTGGGGAGTGGGGGGCTGG - Intronic
960962795 3:123083917-123083939 GCTTATGGGGAGGGGAGGAAAGG + Intronic
961050027 3:123738039-123738061 CTTAAGGGGGAGAGGTGGGCGGG - Intronic
961594089 3:128003137-128003159 CCTTATTGGAAGAGGAGTGTGGG - Intergenic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
963040079 3:141064018-141064040 CCCTGGGGGAAGAGGAGGGCAGG - Intronic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
963823077 3:149921449-149921471 CCTGTTGGGGGGTGGAGGGCTGG - Intronic
964275408 3:155004183-155004205 CCTTATGGGAAAAGAAGGGATGG - Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965617836 3:170612892-170612914 CCCTATTGGGAGAGGAGGGTAGG - Intronic
966155444 3:176911225-176911247 CCTGAGAGAGAGAGGAGGGCTGG - Intergenic
966700386 3:182842647-182842669 CCTTGGGGTGAAAGGAGGGCAGG + Intronic
966712091 3:182980968-182980990 ACTGATGGGGAGGGGAGGTCTGG - Intronic
966744177 3:183260016-183260038 TCTCATCGGGAGGGGAGGGCAGG - Intronic
968489515 4:882498-882520 CCACATGGGGAGGGAAGGGCGGG + Intronic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
969595544 4:8147539-8147561 CCTTATGGGGAGGAGGGAGCGGG + Intronic
970404018 4:15744684-15744706 GCTTAGGGGCAGAGGAGTGCTGG + Intergenic
970609494 4:17711775-17711797 CCTCATGGGGATAGGATGGAAGG + Intronic
975525264 4:75341843-75341865 CCTGTTGGGGGGTGGAGGGCTGG - Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977195063 4:94047939-94047961 CCTGTTGGGGGGTGGAGGGCTGG + Intergenic
980054085 4:128062764-128062786 CTTTATGGGGGGAGGGGGGAGGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982326062 4:154129151-154129173 CCTTGTGGGGTGATGAGGGCTGG + Intergenic
983490102 4:168378977-168378999 CGTTATGGGGAGTGGAGAGTAGG - Intronic
984964034 4:185125854-185125876 CCTTATGGGAAAAGAAGGGATGG - Intergenic
985370906 4:189284437-189284459 GGTTATGGGGAAAGGAGGGGGGG + Intergenic
985399492 4:189580258-189580280 TATTATGGGGAAAGAAGGGCTGG - Intergenic
985578468 5:684559-684581 CCTTGGTGGGACAGGAGGGCTGG - Intronic
985593396 5:776699-776721 CCTTGGTGGGACAGGAGGGCTGG - Intergenic
985619320 5:945643-945665 CATCAAGGTGAGAGGAGGGCTGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
986494895 5:8332078-8332100 CTTCATGGGGAGAAGAGAGCAGG - Intergenic
986954623 5:13136045-13136067 CCTTATGGGGAACGAAGGGATGG + Intergenic
987804498 5:22745755-22745777 CCTTTTGGAGAGTGGAGGGTGGG + Intronic
991014584 5:61917212-61917234 CCATCTGGAGAAAGGAGGGCTGG + Intergenic
991487190 5:67149638-67149660 CCAAATTGGGAGAGGAGGGATGG - Intronic
991933329 5:71777842-71777864 CCTTATGGGGAAAGGAGAGAGGG + Intergenic
992678097 5:79125970-79125992 CCTGATGAAGAGAGGAGAGCTGG + Intronic
994312954 5:98298008-98298030 TCTTATGGGGAGAGGAAAGGAGG + Intergenic
995119560 5:108521178-108521200 GGTTATGGGGAGATGAGGGGAGG + Intergenic
995592747 5:113716381-113716403 CCTTATGGGAAAAGAAGGGATGG - Intergenic
996823128 5:127652663-127652685 CCATCTGTGGAGAGGAGGGGAGG - Intronic
997530644 5:134579342-134579364 CCTTGTGGGGGGACCAGGGCAGG - Exonic
998592282 5:143490280-143490302 CCCTTTGGGGAGATGATGGCTGG + Intergenic
1001456645 5:171866746-171866768 GCTTATTGGGAGGGGAGGTCAGG + Intronic
1001871443 5:175159617-175159639 CATGATGGGGAGTGGAGGGGTGG + Intergenic
1002307130 5:178290466-178290488 CCTTCCGGGGAGAGGTGGCCAGG - Intronic
1002312679 5:178324138-178324160 CCTTTTGGGGGCACGAGGGCTGG + Intronic
1003014348 6:2455994-2456016 CCTGCTGGAGAGAGCAGGGCAGG + Intergenic
1003123906 6:3340056-3340078 CCCTGTGGGGAGAGGAGAGGAGG - Intronic
1003521573 6:6862870-6862892 CCTTATAGGAAGAGGAGGTGAGG - Intergenic
1003985296 6:11429007-11429029 CCCTAGAGGGAGAGGAGCGCTGG - Intergenic
1006082501 6:31575510-31575532 CCCTGGGGCGAGAGGAGGGCGGG - Intergenic
1006389290 6:33749043-33749065 CCTGATAGGGAGAGGAGAGGTGG - Intergenic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1008372142 6:50744944-50744966 CTTTTTGGGGGGAGGAGGGGAGG - Intronic
1008995549 6:57654099-57654121 CCTGTTGGGGAGTGGGGGGCTGG + Intergenic
1009184075 6:60552868-60552890 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1010863876 6:80948089-80948111 CCTTATTGGGAGACCAGGGTAGG + Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1012399401 6:98832055-98832077 CCCTATGCCGGGAGGAGGGCGGG + Intergenic
1012442642 6:99275869-99275891 CCTTGTTGGGTGAGGAGGGACGG - Exonic
1012506458 6:99951895-99951917 CCTGACAGGGAGATGAGGGCAGG + Intronic
1012524501 6:100161074-100161096 CCCTGTAGGGAGAGGAGCGCTGG - Intergenic
1012698694 6:102423396-102423418 ACTTATGGGCAGAGGATGGGAGG + Intergenic
1013004025 6:106053826-106053848 CATTGTGGGGGGTGGAGGGCTGG - Intergenic
1016657913 6:146543286-146543308 CCCTGCGGGGAGAGTAGGGCAGG + Intergenic
1018398204 6:163397472-163397494 TGTTGTGGGGAGGGGAGGGCTGG - Intergenic
1018436283 6:163762160-163762182 CCTTATAGGAAGAGGAGGTTAGG - Intergenic
1018715106 6:166526063-166526085 AGTTATGTGGAGAGGAGGCCTGG - Intronic
1019342731 7:516208-516230 CCTTATCGGGGGCGGAGGGTGGG - Intronic
1019343843 7:520322-520344 TTTTATGGAGAGAGGAAGGCTGG - Intergenic
1019426103 7:977589-977611 CCTCATGGGGAGGGGACGCCTGG - Intergenic
1019783591 7:2959239-2959261 CCTTCTGGAGAAAGGAGGCCAGG + Intronic
1020104142 7:5413372-5413394 ACGGATGGGGAGAGGAGGGAAGG - Intronic
1022679018 7:32526753-32526775 CATTATAGGGTGAGTAGGGCAGG + Intronic
1022722072 7:32950413-32950435 GCTTTTGGGGAGAGCAGGTCAGG + Intergenic
1022737313 7:33088419-33088441 CCTATTGGAGAGAGGAGGGTGGG - Intergenic
1023795582 7:43789432-43789454 TCTTATGGGGAGGAGAAGGCTGG - Intronic
1024102339 7:46044875-46044897 CCTTATGGGGAATGAAGGGATGG + Intergenic
1024303336 7:47904621-47904643 CAGGATGGGGAAAGGAGGGCAGG + Intronic
1026382218 7:69811177-69811199 CCTTATGGGAAGAGTACTGCTGG + Intronic
1028590366 7:92486426-92486448 CTTTATGGTGAAAAGAGGGCAGG + Intergenic
1028652126 7:93161673-93161695 CCTTATGGGAGGGGGAGAGCAGG + Intergenic
1029291177 7:99503646-99503668 GCGTAGGGGGAGGGGAGGGCTGG + Intronic
1030289357 7:107856945-107856967 CCTCATGGAGAGAAGAGGCCAGG + Intergenic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032539894 7:132694264-132694286 CCTTAGCGGGTGAGGAGGGGTGG - Intronic
1032790249 7:135237482-135237504 TAGGATGGGGAGAGGAGGGCAGG - Intronic
1033050177 7:137997030-137997052 CTTTAGGGGGAGAGGTTGGCAGG - Intronic
1033662080 7:143408945-143408967 CCTTAAAGGGACAGTAGGGCAGG + Intergenic
1034164419 7:149014554-149014576 CTTCATGGGGAGGGGAGGGGAGG - Intronic
1034252546 7:149703869-149703891 CCTTATAGGAAGAGGAGGAGCGG - Intergenic
1034680334 7:152923662-152923684 CCTGATTGTGGGAGGAGGGCAGG + Intergenic
1034955546 7:155332127-155332149 CCTTATGAGGAGAGGAGATTAGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1037278265 8:17204651-17204673 CCTTTTGGAGGGAGGAGGGTGGG + Intronic
1037579405 8:20235830-20235852 CCCTGTGGGGAGAGAAGGGGTGG - Intergenic
1039268094 8:35850218-35850240 CATTATGGGGATGGGAGGGAGGG - Intergenic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1041398001 8:57411494-57411516 CTTTCTGGGAAGAGGAGGACAGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1043633232 8:82363440-82363462 CCTGTTGGGGAGTGGGGGGCTGG - Intergenic
1045143809 8:99316287-99316309 CCTTAGTGGCAGCGGAGGGCAGG + Intronic
1045335910 8:101204914-101204936 CGTTTTGGGGAGAGGAGAGGAGG + Exonic
1047145629 8:122195905-122195927 CCTTATGGGCACATGAGGGATGG + Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048664571 8:136646267-136646289 GCCTATGGTGAGAGGAGGACAGG + Intergenic
1050597845 9:7221968-7221990 CCTTTTGGGGGGTGGGGGGCTGG + Intergenic
1050848771 9:10258010-10258032 GCTTGTGGGGAGAAGGGGGCAGG + Intronic
1052036226 9:23684138-23684160 CCTAATGGGGACAGGAGGAGAGG - Intergenic
1053293684 9:36898734-36898756 CCTCATGTGGCGAGGAGAGCCGG - Intronic
1054835344 9:69671097-69671119 CCTTATGGCTAGAGGATGGATGG - Intronic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1055735630 9:79326643-79326665 CCTTATGGAGAAATGAGGGAAGG + Intergenic
1056389379 9:86126552-86126574 CCTTTTGTGGAGAGGAGAGGGGG - Intergenic
1056440540 9:86616643-86616665 CTTTATGAGAAGAGGAGGTCAGG - Intergenic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1058251278 9:102698345-102698367 ATTTGTGGGGAGTGGAGGGCAGG + Intergenic
1058952642 9:109917788-109917810 CCTAAAAGGGAAAGGAGGGCTGG - Intronic
1058973295 9:110102605-110102627 CCCAATGGGGAGGGGAGGGGAGG - Intronic
1059016306 9:110519705-110519727 CCTGATGGAGAGTGGAGGGTGGG + Intronic
1059456222 9:114402015-114402037 CCATGTGGGGAGGGGTGGGCAGG - Intergenic
1060210061 9:121704703-121704725 CCTTATGGAGAGGAGAGGACGGG - Intronic
1060314682 9:122498841-122498863 CCTCATGGGGAGAGGAGAAAAGG - Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1061523554 9:131138238-131138260 GGTTATGGGGAGGGGAGGGGAGG - Intronic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1203435879 Un_GL000195v1:136751-136773 CCTTCTGGGGAGACTAAGGCAGG + Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186453202 X:9690454-9690476 CCTTATGAGAAGAGGAGATCAGG - Intronic
1187158793 X:16745336-16745358 CCACATGGGCAGAGCAGGGCAGG + Intronic
1188313051 X:28641212-28641234 CCTGTTGGGGAGTGGTGGGCTGG - Intronic
1188853111 X:35156496-35156518 CTTTTTGGGGAGAGCAGGACAGG + Intergenic
1189363640 X:40371621-40371643 CCTTATGGGAAGGGGCTGGCAGG + Intergenic
1189394712 X:40610758-40610780 CTTAATGGGGAGAGAAGGGAGGG + Intergenic
1190253462 X:48745073-48745095 CCTTATAAGGAGAGGAGATCAGG - Intergenic
1190258468 X:48782960-48782982 GCTTTGGGGGAGACGAGGGCGGG - Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1194349429 X:92808254-92808276 CCTTAAGGGAGGAGGAGTGCAGG - Intergenic
1197704362 X:129623165-129623187 CCTTGAGGGGCCAGGAGGGCCGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200136248 X:153876079-153876101 GCGGATGGGGAGGGGAGGGCTGG - Intronic
1200657753 Y:5924855-5924877 CCTTAAGGGAGGAGGAGTGCAGG - Intergenic