ID: 1031535921

View in Genome Browser
Species Human (GRCh38)
Location 7:122932587-122932609
Sequence GGTGATGCCCAGGCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535921_1031535923 -4 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535923 7:122932606-122932628 CACCCTGCCCCTGCCCACCATGG No data
1031535921_1031535937 23 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535937 7:122932633-122932655 GGCCCCTTCTGCACCACTAGGGG No data
1031535921_1031535935 21 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535935 7:122932631-122932653 AGGGCCCCTTCTGCACCACTAGG No data
1031535921_1031535927 2 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data
1031535921_1031535926 1 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535926 7:122932611-122932633 TGCCCCTGCCCACCATGGCCAGG No data
1031535921_1031535936 22 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535921 Original CRISPR GGTGATGCCCAGGCTCCTGA TGG (reversed) Intergenic
No off target data available for this crispr