ID: 1031535922

View in Genome Browser
Species Human (GRCh38)
Location 7:122932597-122932619
Sequence GCAGGGGCAGGGTGATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535922_1031535943 26 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535943 7:122932646-122932668 CCACTAGGGGTTCTGAAGGCAGG No data
1031535922_1031535941 22 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535922_1031535926 -9 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535926 7:122932611-122932633 TGCCCCTGCCCACCATGGCCAGG No data
1031535922_1031535937 13 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535937 7:122932633-122932655 GGCCCCTTCTGCACCACTAGGGG No data
1031535922_1031535936 12 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535922_1031535935 11 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535935 7:122932631-122932653 AGGGCCCCTTCTGCACCACTAGG No data
1031535922_1031535927 -8 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535922 Original CRISPR GCAGGGGCAGGGTGATGCCC AGG (reversed) Intergenic
No off target data available for this crispr