ID: 1031535927

View in Genome Browser
Species Human (GRCh38)
Location 7:122932612-122932634
Sequence GCCCCTGCCCACCATGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535922_1031535927 -8 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data
1031535918_1031535927 12 Left 1031535918 7:122932577-122932599 CCTAAGCAATCCATCAGGAGCCT No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data
1031535921_1031535927 2 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data
1031535916_1031535927 27 Left 1031535916 7:122932562-122932584 CCAAAGTCACTCTCACCTAAGCA No data
Right 1031535927 7:122932612-122932634 GCCCCTGCCCACCATGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535927 Original CRISPR GCCCCTGCCCACCATGGCCA GGG Intergenic
No off target data available for this crispr