ID: 1031535928

View in Genome Browser
Species Human (GRCh38)
Location 7:122932613-122932635
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535928_1031535937 -3 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535937 7:122932633-122932655 GGCCCCTTCTGCACCACTAGGGG No data
1031535928_1031535944 18 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535928_1031535941 6 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535928_1031535943 10 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535943 7:122932646-122932668 CCACTAGGGGTTCTGAAGGCAGG No data
1031535928_1031535936 -4 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535928_1031535935 -5 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535935 7:122932631-122932653 AGGGCCCCTTCTGCACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535928 Original CRISPR GCCCTGGCCATGGTGGGCAG GGG (reversed) Intergenic
No off target data available for this crispr