ID: 1031535930

View in Genome Browser
Species Human (GRCh38)
Location 7:122932615-122932637
Sequence GGGCCCTGGCCATGGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535930_1031535936 -6 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535930_1031535937 -5 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535937 7:122932633-122932655 GGCCCCTTCTGCACCACTAGGGG No data
1031535930_1031535943 8 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535943 7:122932646-122932668 CCACTAGGGGTTCTGAAGGCAGG No data
1031535930_1031535935 -7 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535935 7:122932631-122932653 AGGGCCCCTTCTGCACCACTAGG No data
1031535930_1031535941 4 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535930_1031535944 16 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535930 Original CRISPR GGGCCCTGGCCATGGTGGGC AGG (reversed) Intergenic