ID: 1031535934

View in Genome Browser
Species Human (GRCh38)
Location 7:122932629-122932651
Sequence TAGTGGTGCAGAAGGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535934_1031535943 -6 Left 1031535934 7:122932629-122932651 CCAGGGCCCCTTCTGCACCACTA No data
Right 1031535943 7:122932646-122932668 CCACTAGGGGTTCTGAAGGCAGG No data
1031535934_1031535941 -10 Left 1031535934 7:122932629-122932651 CCAGGGCCCCTTCTGCACCACTA No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535934_1031535944 2 Left 1031535934 7:122932629-122932651 CCAGGGCCCCTTCTGCACCACTA No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535934 Original CRISPR TAGTGGTGCAGAAGGGGCCC TGG (reversed) Intergenic
No off target data available for this crispr