ID: 1031535936

View in Genome Browser
Species Human (GRCh38)
Location 7:122932632-122932654
Sequence GGGCCCCTTCTGCACCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535928_1031535936 -4 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535921_1031535936 22 Left 1031535921 7:122932587-122932609 CCATCAGGAGCCTGGGCATCACC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535922_1031535936 12 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535930_1031535936 -6 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535931_1031535936 -10 Left 1031535931 7:122932619-122932641 CCCACCATGGCCAGGGCCCCTTC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535929_1031535936 -5 Left 1031535929 7:122932614-122932636 CCCTGCCCACCATGGCCAGGGCC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535925_1031535936 0 Left 1031535925 7:122932609-122932631 CCTGCCCCTGCCCACCATGGCCA No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data
1031535924_1031535936 1 Left 1031535924 7:122932608-122932630 CCCTGCCCCTGCCCACCATGGCC No data
Right 1031535936 7:122932632-122932654 GGGCCCCTTCTGCACCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535936 Original CRISPR GGGCCCCTTCTGCACCACTA GGG Intergenic
No off target data available for this crispr