ID: 1031535940

View in Genome Browser
Species Human (GRCh38)
Location 7:122932637-122932659
Sequence AGAACCCCTAGTGGTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535940_1031535944 -6 Left 1031535940 7:122932637-122932659 CCTTCTGCACCACTAGGGGTTCT No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535940 Original CRISPR AGAACCCCTAGTGGTGCAGA AGG (reversed) Intergenic
No off target data available for this crispr