ID: 1031535941

View in Genome Browser
Species Human (GRCh38)
Location 7:122932642-122932664
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535928_1031535941 6 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535930_1031535941 4 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535932_1031535941 -1 Left 1031535932 7:122932620-122932642 CCACCATGGCCAGGGCCCCTTCT No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535931_1031535941 0 Left 1031535931 7:122932619-122932641 CCCACCATGGCCAGGGCCCCTTC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535933_1031535941 -4 Left 1031535933 7:122932623-122932645 CCATGGCCAGGGCCCCTTCTGCA No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535929_1031535941 5 Left 1031535929 7:122932614-122932636 CCCTGCCCACCATGGCCAGGGCC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535934_1031535941 -10 Left 1031535934 7:122932629-122932651 CCAGGGCCCCTTCTGCACCACTA No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535922_1031535941 22 Left 1031535922 7:122932597-122932619 CCTGGGCATCACCCTGCCCCTGC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535924_1031535941 11 Left 1031535924 7:122932608-122932630 CCCTGCCCCTGCCCACCATGGCC No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data
1031535925_1031535941 10 Left 1031535925 7:122932609-122932631 CCTGCCCCTGCCCACCATGGCCA No data
Right 1031535941 7:122932642-122932664 TGCACCACTAGGGGTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535941 Original CRISPR TGCACCACTAGGGGTTCTGA AGG Intergenic
No off target data available for this crispr