ID: 1031535944

View in Genome Browser
Species Human (GRCh38)
Location 7:122932654-122932676
Sequence GGTTCTGAAGGCAGGACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031535939_1031535944 -5 Left 1031535939 7:122932636-122932658 CCCTTCTGCACCACTAGGGGTTC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535933_1031535944 8 Left 1031535933 7:122932623-122932645 CCATGGCCAGGGCCCCTTCTGCA No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535929_1031535944 17 Left 1031535929 7:122932614-122932636 CCCTGCCCACCATGGCCAGGGCC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535938_1031535944 -4 Left 1031535938 7:122932635-122932657 CCCCTTCTGCACCACTAGGGGTT No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535940_1031535944 -6 Left 1031535940 7:122932637-122932659 CCTTCTGCACCACTAGGGGTTCT No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535930_1031535944 16 Left 1031535930 7:122932615-122932637 CCTGCCCACCATGGCCAGGGCCC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535934_1031535944 2 Left 1031535934 7:122932629-122932651 CCAGGGCCCCTTCTGCACCACTA No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535931_1031535944 12 Left 1031535931 7:122932619-122932641 CCCACCATGGCCAGGGCCCCTTC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535932_1031535944 11 Left 1031535932 7:122932620-122932642 CCACCATGGCCAGGGCCCCTTCT No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535925_1031535944 22 Left 1031535925 7:122932609-122932631 CCTGCCCCTGCCCACCATGGCCA No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535928_1031535944 18 Left 1031535928 7:122932613-122932635 CCCCTGCCCACCATGGCCAGGGC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data
1031535924_1031535944 23 Left 1031535924 7:122932608-122932630 CCCTGCCCCTGCCCACCATGGCC No data
Right 1031535944 7:122932654-122932676 GGTTCTGAAGGCAGGACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031535944 Original CRISPR GGTTCTGAAGGCAGGACCTC AGG Intergenic
No off target data available for this crispr