ID: 1031538977 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:122970162-122970184 |
| Sequence | CTCCTCTCCTTTGCAAAAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031538977_1031538979 | -6 | Left | 1031538977 | 7:122970162-122970184 | CCTGTTTTTGCAAAGGAGAGGAG | No data | ||
| Right | 1031538979 | 7:122970179-122970201 | GAGGAGGAACAGACTTGAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031538977 | Original CRISPR | CTCCTCTCCTTTGCAAAAAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||