ID: 1031538977

View in Genome Browser
Species Human (GRCh38)
Location 7:122970162-122970184
Sequence CTCCTCTCCTTTGCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031538977_1031538979 -6 Left 1031538977 7:122970162-122970184 CCTGTTTTTGCAAAGGAGAGGAG No data
Right 1031538979 7:122970179-122970201 GAGGAGGAACAGACTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031538977 Original CRISPR CTCCTCTCCTTTGCAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr