ID: 1031544490

View in Genome Browser
Species Human (GRCh38)
Location 7:123034892-123034914
Sequence GAACCCAGAATTGCAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031544490_1031544493 9 Left 1031544490 7:123034892-123034914 CCTGTTCCTGCAATTCTGGGTTC No data
Right 1031544493 7:123034924-123034946 GCACATTCTAGTCCCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031544490 Original CRISPR GAACCCAGAATTGCAGGAAC AGG (reversed) Intergenic
No off target data available for this crispr