ID: 1031552475

View in Genome Browser
Species Human (GRCh38)
Location 7:123132224-123132246
Sequence TTTTATTAGTAGTGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1245
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 1196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031552475_1031552479 10 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA 0: 1
1: 0
2: 3
3: 45
4: 1196
Right 1031552479 7:123132257-123132279 TCTGGAGAAAAAGCAGAAAGAGG 0: 1
1: 0
2: 9
3: 80
4: 713
1031552475_1031552477 -8 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA 0: 1
1: 0
2: 3
3: 45
4: 1196
Right 1031552477 7:123132239-123132261 TAATAAAACCATGGCAGTTCTGG No data
1031552475_1031552481 21 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA 0: 1
1: 0
2: 3
3: 45
4: 1196
Right 1031552481 7:123132268-123132290 AGCAGAAAGAGGAATCAAGAGGG No data
1031552475_1031552480 20 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA 0: 1
1: 0
2: 3
3: 45
4: 1196
Right 1031552480 7:123132267-123132289 AAGCAGAAAGAGGAATCAAGAGG 0: 1
1: 1
2: 2
3: 69
4: 717
1031552475_1031552482 22 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA 0: 1
1: 0
2: 3
3: 45
4: 1196
Right 1031552482 7:123132269-123132291 GCAGAAAGAGGAATCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031552475 Original CRISPR TTTTATTAGTAGTGAGAAGA TGG (reversed) Intronic
900692622 1:3990197-3990219 CTTTATTAGCAGTGTGAAAACGG + Intergenic
900700014 1:4041090-4041112 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
901959966 1:12818603-12818625 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
903683814 1:25116354-25116376 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
904352672 1:29919051-29919073 CTTTATCAGTAGTGTGAAAATGG - Intergenic
904430064 1:30458568-30458590 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
904706747 1:32396551-32396573 CTTTATTAGCAGTGTGAAAATGG - Intergenic
905840942 1:41177397-41177419 TTTGATGAGTTGAGAGAAGAAGG + Intronic
906008511 1:42501439-42501461 TTTGATGAGTTGAGAGAAGAAGG - Intronic
906486417 1:46238859-46238881 CTTTATAAGTAGTGTGAAAATGG - Intergenic
906571735 1:46847304-46847326 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
906605499 1:47167060-47167082 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
906752546 1:48278339-48278361 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
906851778 1:49258313-49258335 TTTGATGAGTTGAGAGAAGAAGG + Intronic
906908053 1:49916241-49916263 TTTGATGAGTTGAGAGAAGAGGG + Intronic
906909833 1:49935994-49936016 TTTGATGAGTTGAGAGAAGAAGG + Intronic
907228980 1:52977325-52977347 TTTTATTTGTTGTGATATGAGGG + Intronic
907231789 1:53005776-53005798 TTTGATGAGTTGAGAGAAGAAGG + Intronic
907356170 1:53875876-53875898 ATTTAATAGCAGAGAGAAGAAGG - Intronic
907435949 1:54448251-54448273 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
907926488 1:58959278-58959300 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
908099615 1:60777513-60777535 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
908637980 1:66189818-66189840 TTTGATGAGTTGAGAGAAGAAGG - Intronic
908765281 1:67549196-67549218 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
908978632 1:69927792-69927814 TTTGATGAGTTGAGAGAAGAAGG - Intronic
909180374 1:72416126-72416148 CTTTATTAGCAGTGTGAAAATGG + Intergenic
909235770 1:73151627-73151649 CTTTATTAGCAGTGTGAAAATGG - Intergenic
909405433 1:75282896-75282918 TTTTATTAGCAGTGTGAGAATGG + Intronic
909514039 1:76487710-76487732 TTTGACAAGTAGAGAGAAGAAGG - Intronic
909648747 1:77949345-77949367 TTTTATTAGAAATGAGATGTTGG - Intronic
909694722 1:78453956-78453978 CTTTATCAGTAGTGTGAAAATGG + Intronic
909704164 1:78561662-78561684 CTTTATTAGCAGTGTGAAAATGG + Intergenic
909808670 1:79904703-79904725 TTTTATTAGCAGCACGAAGACGG - Intergenic
910067291 1:83168575-83168597 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
910381618 1:86632944-86632966 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
910610671 1:89138650-89138672 TTTTGTATATAGTGAGAAGAAGG - Intronic
910709876 1:90167984-90168006 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
910930138 1:92435750-92435772 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
911391387 1:97248509-97248531 CTTTATTAGCAGTGTGAAAATGG + Intronic
911403999 1:97413313-97413335 GTTCTTTAGTAGGGAGAAGATGG - Intronic
911556785 1:99354676-99354698 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
912297889 1:108487621-108487643 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
912741653 1:112204131-112204153 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
912942193 1:114055283-114055305 TTTTATTATTATTGTAAAGAGGG - Intergenic
913033229 1:114933552-114933574 TTTGATGAGTTGAGAGAAGAAGG + Intronic
913040580 1:115019013-115019035 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
914208604 1:145558300-145558322 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
914403318 1:147344128-147344150 TTTGAGAAGTTGTGAGAAGAAGG + Intergenic
914583367 1:149039984-149040006 TTTGATGAGTTGAGAGAAGAAGG - Intronic
914957815 1:152180401-152180423 TTTTGCTAGTAGAGAGAATAAGG + Intergenic
915752032 1:158220781-158220803 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
915872256 1:159573938-159573960 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
915886904 1:159731580-159731602 TTTGATGAGTTGAGAGAAGAGGG + Intergenic
915987353 1:160480287-160480309 TTTGATGAGTGGAGAGAAGAAGG - Intergenic
916221528 1:162449314-162449336 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
916295239 1:163211941-163211963 TAATATTTGTAGTGAGAACATGG - Intronic
916308248 1:163364116-163364138 TTTTATTAAAAGTTGGAAGAAGG - Intergenic
916783549 1:168063242-168063264 TTTTCTTAATATGGAGAAGAGGG + Intronic
916915486 1:169401803-169401825 TTTGATGAGTTGAGAGAAGAAGG + Intronic
917051155 1:170925080-170925102 CTTTATTAGCAGTGTGAAAATGG + Intergenic
917166409 1:172117642-172117664 TTTTATCAGCAGTGTGAAAATGG + Intronic
917290576 1:173468553-173468575 TTTTATTAGTAGCGTGAGAACGG - Intergenic
917681672 1:177374358-177374380 CTTTATTAGCAGTGTGAAAACGG - Intergenic
917893632 1:179465108-179465130 TTTGATGAGTTGAGAGAAGAAGG - Intronic
917987412 1:180334668-180334690 TTTGATGAGTTGAGAGAAGAAGG + Intronic
918202171 1:182277859-182277881 TTTTATCAGCAGTGTGAAAATGG - Intergenic
918231408 1:182536592-182536614 CTTTATTAGCAGTGTGAAAATGG - Intronic
918397982 1:184135552-184135574 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
918548152 1:185708536-185708558 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
918554523 1:185783330-185783352 TTTGATAAGTTGAGAGAAGAAGG - Intronic
918847297 1:189634153-189634175 CTTTATTAGCAGTGTGAAAACGG - Intergenic
919065389 1:192687711-192687733 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
919142753 1:193593225-193593247 TTTCATTTGTACTGAGATGAAGG - Intergenic
919654792 1:200186508-200186530 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
919900688 1:202042310-202042332 TATTGTTATTACTGAGAAGAGGG + Intergenic
920041181 1:203098548-203098570 TCTTATTAGAACTGAGAAGCAGG - Intronic
920632091 1:207662631-207662653 TTTGATGAGTTGAGAGAAGAAGG - Intronic
920955361 1:210615422-210615444 TTTGATGAGTTGAGAGAAGAAGG - Intronic
921285749 1:213607835-213607857 TTTTATTTCTAGTTAGAATAGGG + Intergenic
921391624 1:214621139-214621161 TTTTATTTGTATTGAAAAGCTGG + Intronic
923323944 1:232863844-232863866 TTTTATGACTAATGATAAGACGG - Intergenic
923726591 1:236510876-236510898 TTTTTTTAGTAGAGATGAGATGG + Intergenic
924695858 1:246398889-246398911 TTTTATTAATAGTAGAAAGAGGG - Intronic
1063111265 10:3039415-3039437 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1063599928 10:7471593-7471615 TTTTATGGATAGTGAGAAGTAGG - Intergenic
1064401986 10:15029162-15029184 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1064406146 10:15065412-15065434 TTTTGAAAGTAGGGAGAAGAAGG - Intronic
1064474221 10:15669503-15669525 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1064588847 10:16867381-16867403 TATTGTTTGTAGTGAGGAGAGGG - Intronic
1064852994 10:19731291-19731313 TTTTATAAGCAGGGAGAAAATGG + Intronic
1064919433 10:20500612-20500634 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1064924675 10:20556563-20556585 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1065049782 10:21779752-21779774 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1065055036 10:21835484-21835506 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1065071823 10:22032611-22032633 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1065081076 10:22130308-22130330 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1065222473 10:23510911-23510933 TTTGATGAGTTGGGAGAAGAAGG - Intergenic
1065649719 10:27875339-27875361 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1066060357 10:31718659-31718681 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1066168655 10:32816993-32817015 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1066701479 10:38134278-38134300 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1066709457 10:38217412-38217434 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1067199132 10:44151388-44151410 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1067241221 10:44496629-44496651 TTTGAAAGGTAGTGAGAAGACGG + Intergenic
1067537598 10:47125384-47125406 TTTTATTATCAGTGAGATGGGGG + Intergenic
1068085104 10:52365170-52365192 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1068552507 10:58422721-58422743 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1068711613 10:60141189-60141211 TTTTATCAGGAGTTTGAAGAAGG + Intronic
1068821132 10:61378370-61378392 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1069044861 10:63732559-63732581 TTTTATGTGTGGTAAGAAGAAGG + Intergenic
1069066704 10:63949629-63949651 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1069370105 10:67738596-67738618 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1069437033 10:68393863-68393885 TTTTATTAATAGTATGAAGTGGG - Intronic
1070477861 10:76847366-76847388 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1070633665 10:78106687-78106709 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1071005797 10:80882608-80882630 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1071211038 10:83342363-83342385 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1071244307 10:83746195-83746217 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1071247962 10:83786043-83786065 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1071764937 10:88652919-88652941 TTTTATCAGTATTGAAAAGTAGG - Intergenic
1071825086 10:89317216-89317238 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1071900681 10:90118050-90118072 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1071924315 10:90388025-90388047 TTTTATTAGTAAAGAGTAAAAGG + Intergenic
1071999087 10:91176890-91176912 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1072047862 10:91674676-91674698 TTTTATTACTATGGAAAAGAGGG - Intergenic
1072697882 10:97617510-97617532 TTTAATCTGTAGTGATAAGATGG - Intronic
1072852813 10:98914379-98914401 CTTTATTAGCAGTGTGAAAATGG + Intronic
1073296850 10:102445477-102445499 TTTTATTATTAGTGGGTGGAGGG - Intergenic
1073436150 10:103517347-103517369 TATTATTAGAAGTTTGAAGAAGG - Intronic
1073895823 10:108156313-108156335 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1074027736 10:109653503-109653525 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1074069402 10:110050835-110050857 TTTTTTTAGCAGTGTGAAAATGG + Intronic
1074468951 10:113709349-113709371 TTTTATTATTACAGAGAAGAAGG + Intronic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1074653923 10:115560209-115560231 CTTTATTAGCAGTGTGAATATGG - Intronic
1074659180 10:115632092-115632114 TTTTATTACTAAAAAGAAGAAGG + Intronic
1074665729 10:115721409-115721431 CTTTATCAGTAGTGTGAAAAGGG - Intronic
1075057483 10:119230324-119230346 CTTTATCAGTAGTGTGAAAATGG - Intronic
1075550512 10:123389344-123389366 CTTTATTAGCAGTGCGAAAATGG + Intergenic
1076155528 10:128202240-128202262 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1076248355 10:128965150-128965172 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1076351553 10:129818332-129818354 CTTTATCAGTAGTGTGAAAATGG + Intergenic
1077198220 11:1291981-1292003 TTTGATTAGAAGTGAAAGGAGGG - Intronic
1077654039 11:4000743-4000765 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1078027624 11:7712245-7712267 GATTATAAGTAGTGAAAAGAAGG + Intergenic
1078280011 11:9891959-9891981 TTATATTTGTAATGAAAAGATGG - Intronic
1078419786 11:11200836-11200858 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1078496560 11:11823830-11823852 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1078628403 11:12979599-12979621 TTTTTTTTTTAGTGAGAGGAAGG - Intergenic
1078826221 11:14933137-14933159 CTTTATTAGCAGTGTGAAAATGG - Intronic
1078977819 11:16497474-16497496 TTTGATAAGTTGAGAGAAGAAGG + Intronic
1079143733 11:17832459-17832481 GTTTATTAGCAGTGTGAAAATGG + Intronic
1079213502 11:18485230-18485252 ATTTAATGGTAGAGAGAAGATGG - Intronic
1079484279 11:20918449-20918471 CTTTATCAGCAGTGAGAAAACGG - Intronic
1079642375 11:22822857-22822879 TTTTCTTAGTAGTTAAAAAATGG - Exonic
1079657687 11:23002902-23002924 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1079683052 11:23322107-23322129 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1079698418 11:23513562-23513584 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1079873867 11:25832429-25832451 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1079894414 11:26100696-26100718 TGTTATTAGGCCTGAGAAGATGG + Intergenic
1080993906 11:37577679-37577701 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1081257208 11:40911703-40911725 TTTTATGAGTTGAGAGAAGAAGG + Intronic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1081851385 11:46277566-46277588 ATTTAATATTAATGAGAAGAGGG - Intergenic
1082096322 11:48133291-48133313 GTTTAGTATTAGTGAGGAGAGGG + Intronic
1082103076 11:48190729-48190751 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1082117941 11:48347138-48347160 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1082124372 11:48415059-48415081 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1082135689 11:48546887-48546909 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1082145125 11:48657725-48657747 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1082147176 11:48684158-48684180 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1082150292 11:48730414-48730436 TTTGATGAGCTGTGAGAAGAAGG + Intergenic
1082155338 11:48803410-48803432 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1082214202 11:49547360-49547382 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1082314080 11:50695587-50695609 TTTGATGAGTTGGGAGAAGAAGG + Intergenic
1082317704 11:50750097-50750119 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1082684454 11:56220607-56220629 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1082951162 11:58817105-58817127 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1083009802 11:59386632-59386654 TTTAATGAGTTGAGAGAAGAAGG - Intergenic
1083496322 11:63057440-63057462 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1083498191 11:63077939-63077961 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1084343917 11:68530239-68530261 TTTTAATAGTGGTGAGAGAAGGG + Intronic
1085155938 11:74294431-74294453 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1085225872 11:74920825-74920847 TTTTATTACTATTAAGAGGAAGG + Intronic
1086006660 11:82046463-82046485 CTTTATTAGTAGTGTGAGAATGG + Intergenic
1086078540 11:82879521-82879543 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1086529091 11:87763373-87763395 TTTGATTAGTTGAGAGAAGAAGG - Intergenic
1086730377 11:90241205-90241227 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1086801122 11:91176641-91176663 TTTTATTAGGAGTAACAGGATGG - Intergenic
1087108269 11:94433795-94433817 GTTTATCAGCAGTGAGAAAATGG + Intronic
1087111951 11:94480073-94480095 TTTTATTCGTAGTGGGGGGAGGG + Intronic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1087311760 11:96552093-96552115 TTTAATTCGTAAGGAGAAGAGGG - Intergenic
1087333055 11:96807427-96807449 TATACTTAGTAGTGAGAAGGTGG - Intergenic
1087606851 11:100387306-100387328 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1087609624 11:100418421-100418443 TTCTATTAGTAAAAAGAAGATGG + Intergenic
1088155413 11:106797258-106797280 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1088309210 11:108441974-108441996 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1088490947 11:110387747-110387769 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1088790887 11:113225090-113225112 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1088958709 11:114638449-114638471 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1089040378 11:115442965-115442987 TTTTATAAGTAGATACAAGAGGG + Intronic
1089193944 11:116680451-116680473 TTTTATTGGAGGTTAGAAGATGG - Intergenic
1089859349 11:121574988-121575010 TATTATTAGAAGTTAGCAGATGG + Intronic
1090322403 11:125858491-125858513 TTTGACAAGTAGAGAGAAGAAGG + Intergenic
1090579214 11:128141208-128141230 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1090706621 11:129343898-129343920 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1091052410 11:132384562-132384584 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1091246721 11:134102521-134102543 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1091326513 11:134693213-134693235 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1091424501 12:375559-375581 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1091561611 12:1618620-1618642 TTTTATTAGTATTCAGGAGAAGG + Intronic
1091942957 12:4506688-4506710 GTTTAGTAATAGTAAGAAGATGG + Intronic
1091959893 12:4684694-4684716 TTTCATTAGCAGTGAAGAGATGG + Intronic
1091968344 12:4764367-4764389 TTCCAGTAGCAGTGAGAAGATGG - Intronic
1092560868 12:9611462-9611484 TTTGATGAGTTGAGAGAAGATGG + Intergenic
1092662515 12:10754503-10754525 CTTTATCAGTAGTGAGAAAAAGG - Intergenic
1093217591 12:16382122-16382144 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1093260762 12:16934857-16934879 TTTTGTTTATAGTGAGAAGTAGG + Intergenic
1093404372 12:18786362-18786384 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1093579467 12:20770099-20770121 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1093974097 12:25401860-25401882 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1094013473 12:25834776-25834798 TTTTTTTAGTAATGAAAAAATGG - Intergenic
1094092929 12:26670707-26670729 TTTTACGAGTTGAGAGAAGAAGG + Intronic
1094706233 12:32916588-32916610 CTTTATCAGTAGTGTGAAAATGG + Intergenic
1094728377 12:33146760-33146782 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1094767732 12:33617535-33617557 TTTTATTAGCAGTGTGAGAATGG + Intergenic
1094780399 12:33785635-33785657 TTTCATGAGCAGGGAGAAGAAGG - Intergenic
1094805305 12:34084381-34084403 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1095224953 12:39669037-39669059 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG + Intergenic
1095867940 12:46992956-46992978 TTTGATTAGTTGAGAGAAGAAGG + Intergenic
1095967870 12:47881583-47881605 TTTTTTGAGTAGTGAGCATATGG + Intronic
1096175583 12:49515707-49515729 ATTTCTTAGTTTTGAGAAGAAGG + Intronic
1097310517 12:58114268-58114290 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1097420820 12:59376991-59377013 TATTATTAGTATTGTCAAGATGG + Intergenic
1097940522 12:65299639-65299661 TTCTATTACTAATAAGAAGAAGG + Intronic
1098228100 12:68345567-68345589 TTTTATTTTTAGTGAAAACAGGG + Intergenic
1098613999 12:72499932-72499954 TTTTATTATTATTAATAAGAGGG + Intronic
1098671960 12:73241985-73242007 TGTTAATAGTATTAAGAAGAGGG - Intergenic
1099261393 12:80386980-80387002 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1099291143 12:80777634-80777656 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1099295284 12:80822037-80822059 CTTTATTAGCAGTGTGAAAACGG - Intronic
1099383767 12:81989023-81989045 TTTTATTAGTAGTGTGAGAATGG - Intergenic
1099746781 12:86714711-86714733 CTTTATCAGTAGTGTGAAAATGG + Intronic
1099764996 12:86971535-86971557 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1099795560 12:87395066-87395088 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1099936808 12:89136027-89136049 TATTATTAATAGTAAAAAGAAGG - Intergenic
1100038363 12:90281040-90281062 TTTTATTAGCAGTGTGAGAATGG + Intergenic
1100280323 12:93112368-93112390 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1100504637 12:95207368-95207390 TTTTATTAGTAGCGTGAGAACGG + Intronic
1100563939 12:95776318-95776340 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1100604180 12:96137610-96137632 TATTATTATTAGTGAGAAACAGG - Intergenic
1100766061 12:97866693-97866715 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1100907679 12:99320685-99320707 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1101083656 12:101213882-101213904 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1102440244 12:112958329-112958351 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1102885571 12:116519176-116519198 TTTTGTTTGCAGGGAGAAGAAGG - Intergenic
1103067326 12:117910346-117910368 TTTTATTACAAGTGAGGAAATGG - Intronic
1103604076 12:122074084-122074106 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1104128915 12:125873900-125873922 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1104831481 12:131755141-131755163 TTTTATTAGTACTGAGGCGTGGG - Intronic
1105565508 13:21543182-21543204 TTTTATTAGTGATATGAAGAAGG - Intronic
1105789192 13:23780611-23780633 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1105992719 13:25638264-25638286 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1106126504 13:26904085-26904107 CTTTATCAGTAGTGTGAAAACGG + Intergenic
1106262136 13:28077254-28077276 TTTTATCAGCAGTGTGAAAACGG - Intronic
1106646199 13:31637410-31637432 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106734662 13:32577157-32577179 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1107090390 13:36473273-36473295 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
1107232779 13:38130334-38130356 TTTTATTAGCAGAGTGAAAACGG + Intergenic
1107252060 13:38375826-38375848 TTATATTTGTAGTGAATAGAAGG + Intergenic
1107393350 13:39990553-39990575 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1107491904 13:40888103-40888125 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1107764190 13:43716043-43716065 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1107900756 13:45011359-45011381 CTTTATTAGCAGTGTGAAAATGG - Intronic
1107973634 13:45669049-45669071 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1108190865 13:47937443-47937465 CTTTATTAGCAGTGTGAAAATGG + Intronic
1108547880 13:51514684-51514706 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1108927213 13:55768143-55768165 TTTTAAAAGTAGTGATAGGAGGG + Intergenic
1109216868 13:59599060-59599082 CTTTATCAGTAGTGTGAAAACGG - Intergenic
1109447157 13:62455951-62455973 TTTTATTAATAGTACCAAGATGG - Intergenic
1109496560 13:63179108-63179130 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1109745585 13:66619319-66619341 TTTTATTAGTCTTTAGAAAATGG + Intronic
1109838896 13:67896645-67896667 TTTTATTAGTAGTTATTATAGGG - Intergenic
1110038573 13:70719239-70719261 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1110257594 13:73449045-73449067 TTTTATAATTTGGGAGAAGAAGG + Intergenic
1110510397 13:76343426-76343448 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1110698317 13:78518191-78518213 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1110729126 13:78859891-78859913 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1110976203 13:81838979-81839001 CTTTATTAGTAGTGTGACAATGG - Intergenic
1111122053 13:83865934-83865956 TTATATTAGAAGTCATAAGAGGG + Intergenic
1111157859 13:84352308-84352330 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1111594274 13:90390514-90390536 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1111615200 13:90653386-90653408 CTTTATTAGCAGTGTGAAAAAGG + Intergenic
1111756083 13:92397497-92397519 TTTTATTAGCAGCGTGAAAACGG + Intronic
1111967134 13:94871921-94871943 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1112033840 13:95479949-95479971 CTTTATTAGCAGTGTGAAGATGG - Intronic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112281823 13:98069451-98069473 TTTTATCAGCAGTGTGAAAACGG + Intergenic
1112663708 13:101544037-101544059 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1112820408 13:103327926-103327948 ATTTTTTAGTACTGAGAGGATGG - Intergenic
1112835298 13:103507486-103507508 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1113021187 13:105889366-105889388 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1113048843 13:106186105-106186127 CTTTATTAGCAGTGTGAACATGG + Intergenic
1113488206 13:110670712-110670734 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1113567997 13:111330527-111330549 TTTTATCTGTAGTCAGAGGAAGG - Intronic
1114034395 14:18608989-18609011 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1114079201 14:19188166-19188188 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1114124248 14:19706020-19706042 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1114391310 14:22311543-22311565 TTGAATTAGTGGTTAGAAGAGGG - Intergenic
1114687409 14:24547360-24547382 CTTTATTAGCAATGTGAAGATGG - Intergenic
1114691468 14:24586670-24586692 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1114762757 14:25335080-25335102 ATTTATTAACAGTGAGAAAATGG - Intergenic
1114801032 14:25776302-25776324 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1115107312 14:29776302-29776324 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1115383093 14:32762124-32762146 TTTTAGTAGTAGGGGGAAAAAGG - Intronic
1115624764 14:35179722-35179744 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1115679698 14:35722829-35722851 TTTTCTTAGAACTGAGAAGGTGG - Intronic
1115792636 14:36897520-36897542 TTTGATGAGTTGGGAGAAGAAGG - Intronic
1115883210 14:37944139-37944161 CTTTATTAGCAGTGTGAAAATGG - Intronic
1116247993 14:42442291-42442313 TTTTTTTTGGAGTGAGAATATGG - Intergenic
1116274692 14:42817402-42817424 TTTTAACAGGAGTGAGGAGATGG - Intergenic
1116489070 14:45485621-45485643 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1116871839 14:50074993-50075015 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1117086157 14:52203540-52203562 TTTTATTAGAAGGGAGACAATGG + Intergenic
1117115222 14:52503732-52503754 TTTCATGAGTTGAGAGAAGAAGG + Intronic
1117188861 14:53271395-53271417 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1117451822 14:55858545-55858567 TTTTATCAGCAGTGTGAAAACGG + Intergenic
1117468511 14:56019001-56019023 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1117648123 14:57873931-57873953 TTTTATTATTTATGAGAACATGG - Intronic
1117661631 14:58012140-58012162 TTTTTTTCCTAGTGAGAAGCTGG - Exonic
1117807999 14:59514323-59514345 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1117952493 14:61097251-61097273 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1118432007 14:65728256-65728278 CTTTATTAGCAGTGTGAAAATGG - Intronic
1118958235 14:70502457-70502479 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1119100681 14:71877669-71877691 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1119631419 14:76235573-76235595 TTTTATTAGCAGTGTAAAAATGG + Intronic
1119672781 14:76532099-76532121 TTGTAATATTAGTGGGAAGAGGG - Intergenic
1119697414 14:76724631-76724653 CTTTATTAGTAGCGAGAGAACGG - Intergenic
1119773921 14:77237052-77237074 TTTCATTAGGGGTGAGAGGATGG - Intronic
1119835024 14:77741478-77741500 TTTTCTCAGGAGTGAGAAGAGGG + Intronic
1120152603 14:81054349-81054371 CTTTATTAGCAGTGTGAAAATGG + Intronic
1120312697 14:82851072-82851094 CTTTATTAGCAGTGTGAATATGG + Intergenic
1120366911 14:83582705-83582727 CTTTATTGGTAGTGTGAAAATGG + Intergenic
1120569804 14:86102927-86102949 TTTTATTACTCATGAGAACACGG + Intergenic
1120574929 14:86169948-86169970 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1120692424 14:87607122-87607144 CTTTATCAGCAGTGAGAAAAGGG - Intergenic
1123397286 15:19949360-19949382 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1123455229 15:20416464-20416486 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1124842086 15:33251702-33251724 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1125243707 15:37608106-37608128 TATAAATAGGAGTGAGAAGAGGG + Intergenic
1125341706 15:38682168-38682190 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1125463239 15:39926033-39926055 GTTTATTAGTAGTGGCAAAAAGG + Intergenic
1125660940 15:41394204-41394226 TTTTTTTAGTAGAGACAACAGGG + Intronic
1126778842 15:52120951-52120973 GTTTATTTGAAGTGAGATGATGG + Exonic
1126822700 15:52520464-52520486 TTTTTTTAGGGGTGAAAAGATGG - Intronic
1126841827 15:52724788-52724810 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1126889086 15:53184381-53184403 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1128757821 15:70195427-70195449 TTTTCTTGGTCGTGAGCAGATGG + Intergenic
1128989213 15:72244820-72244842 CTTTATCAGTAGTGTGAAAATGG - Intronic
1129010552 15:72412569-72412591 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1129070293 15:72945363-72945385 TTTTTATAGTAGTGTGAAAACGG - Intergenic
1129097069 15:73220910-73220932 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1129370018 15:75086869-75086891 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1129469620 15:75743738-75743760 TTTTATGAGCAGTGTGAAAACGG + Intergenic
1129631095 15:77261279-77261301 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1131477874 15:92755762-92755784 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1131555465 15:93394940-93394962 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1131568771 15:93510680-93510702 TTGTAGTAGTAGTGAGAATGGGG + Intergenic
1131678316 15:94694555-94694577 TTTTATTGGTATTGAGAATTTGG + Intergenic
1131918290 15:97295154-97295176 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1131961966 15:97799447-97799469 TTTTAATAGTAGTGCAAAAATGG - Intergenic
1132189040 15:99832938-99832960 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1133488652 16:6245580-6245602 TATTATTATTAGTGTGTAGAGGG - Intronic
1134686474 16:16162189-16162211 TCTTTTTAGCAGTGTGAAGATGG + Intronic
1135148331 16:19983247-19983269 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1135529302 16:23238929-23238951 TTTTATTAGCAGTGTGAAAACGG - Intergenic
1135677424 16:24428773-24428795 TTTTATTTTTATTGTGAAGATGG + Intergenic
1137032571 16:35537654-35537676 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1137041359 16:35615814-35615836 TTTTATGGGTAGTAGGAAGAAGG + Intergenic
1137074486 16:35944844-35944866 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1137525226 16:49229218-49229240 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1138380194 16:56595345-56595367 TTTTATTAATAGTGAGGGGTGGG + Intergenic
1138692780 16:58784857-58784879 TTTGATCAGTTGCGAGAAGAAGG - Intergenic
1139105365 16:63820816-63820838 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1139133750 16:64177477-64177499 TTCTATTAGAAGTGTGAAAATGG + Intergenic
1140015451 16:71178054-71178076 ATTTTTTAGAAGTGAAAAGAAGG + Intronic
1140267892 16:73435986-73436008 CTTTATCAGCAGTGAGAAAACGG - Intergenic
1141251140 16:82360088-82360110 TTTGAGTAGTAGTAAAAAGAGGG + Intergenic
1143257694 17:5573964-5573986 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1143865993 17:9924530-9924552 ATTTATTGGTAGAGAGAAGGGGG - Intronic
1145396660 17:22501921-22501943 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1145716714 17:27029740-27029762 TTTGATGAGTAGAGAGAAGAAGG + Intergenic
1146115151 17:30130038-30130060 TTCTATTAGAAGTGGGGAGATGG + Intronic
1146697247 17:34919101-34919123 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1146732223 17:35203795-35203817 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1147527636 17:41241041-41241063 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1147893121 17:43731504-43731526 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1148281217 17:46348966-46348988 TTTTATTAGAAGTCACAAAATGG - Intronic
1148303445 17:46566901-46566923 TTTTATTAGAAGTCACAAAATGG - Intronic
1148702635 17:49598938-49598960 TTTTATATTTAGTTAGAAGAAGG + Exonic
1148800824 17:50224635-50224657 CTTTATTAACAGTGAGAAAATGG - Intergenic
1148953091 17:51331925-51331947 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1149167630 17:53772154-53772176 TTTTATTAGTTGAAAGAGGAGGG + Intergenic
1149408723 17:56381443-56381465 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1150191478 17:63245025-63245047 CTTTATTAGCAGTGTGAAAATGG + Intronic
1150866818 17:68859979-68860001 TTTTCTTAGTTGTGAGGGGAAGG + Intergenic
1150907950 17:69358759-69358781 TTGTGGTAGTAGTGAGAAGTAGG + Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151911171 17:77084228-77084250 TTATTTTAGTAGAGACAAGAAGG - Intergenic
1153199522 18:2634298-2634320 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1153455117 18:5272118-5272140 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1153588408 18:6647587-6647609 TTTTATTAGCAGTGTGAGAATGG - Intergenic
1154401469 18:14042578-14042600 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1154403569 18:14066128-14066150 TTTCATGAGTTGAGAGAAGAAGG + Intronic
1154414043 18:14163796-14163818 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1155476775 18:26243572-26243594 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1155740788 18:29285417-29285439 TTTTATTAGGAATGAGAGAATGG - Intergenic
1155772162 18:29715240-29715262 TTTGATTAGAAGTGAAAAGTAGG + Intergenic
1155810508 18:30227233-30227255 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1156103182 18:33623745-33623767 TTTCATCAGTAGTTAGAAAAGGG + Intronic
1156433542 18:37101174-37101196 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1156593078 18:38513282-38513304 TCTTATCAGTAGTGTGAAAATGG + Intergenic
1156722006 18:40081696-40081718 TTTTATTAGTAGGGAATAGCGGG - Intergenic
1156741765 18:40339419-40339441 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1156965462 18:43086037-43086059 CTTTATCAGCAGTGTGAAGATGG + Intronic
1157047403 18:44119069-44119091 TTTCATTAGTACTTGGAAGATGG - Intergenic
1157777748 18:50409249-50409271 TTTACTTGGTAGTCAGAAGAGGG + Intergenic
1157984099 18:52417856-52417878 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1158100277 18:53822024-53822046 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1158101305 18:53833360-53833382 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1158271363 18:55720486-55720508 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1158772912 18:60543229-60543251 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1159099459 18:63941507-63941529 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1159254211 18:65924604-65924626 TTTTATTAGCAGTGTGAGAACGG + Intergenic
1159629900 18:70736993-70737015 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1159753387 18:72330999-72331021 TTTTATTGGTCTTGATAAGAGGG - Intergenic
1160331212 18:77993559-77993581 TTTTATCAGTAGCGTGAAAACGG - Intergenic
1160348795 18:78156243-78156265 ATTTGTTAGCAGTGTGAAGAGGG + Intergenic
1162855822 19:13467775-13467797 TTTTATTTTTAGTGAGGATAGGG + Intronic
1163539860 19:17901590-17901612 CTTTATTAGTAGCGTGAAAATGG + Intergenic
1163858453 19:19726070-19726092 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1163972183 19:20808853-20808875 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1164092059 19:21964535-21964557 TTTTTTCATTAGAGAGAAGAAGG - Intronic
1164111679 19:22167689-22167711 TTTTATAATTAGAGACAAGAAGG - Intergenic
1164248511 19:23456730-23456752 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1164307543 19:24018321-24018343 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1164541257 19:29123128-29123150 TTTAATTAGCAGTGTGAAAATGG - Intergenic
1164568482 19:29349493-29349515 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1164883888 19:31760554-31760576 TTTTCTTTGGAGTGAGAAGTGGG + Intergenic
1164959551 19:32416088-32416110 TTTTATGAGTGATGAGGAGAAGG + Intronic
1165607448 19:37117628-37117650 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1166433680 19:42748930-42748952 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1166446506 19:42862516-42862538 TTTCATAAGTTGAGAGAAGAAGG - Intronic
1166917993 19:46208879-46208901 TTTTTTTAGCAGTGTGAAAATGG + Intergenic
1166972564 19:46579510-46579532 TTTTAATAATAGAGAGATGATGG - Intronic
1167199531 19:48054812-48054834 TTTTATTAGCAGTGTGAGCATGG + Intronic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395547 2:3530860-3530882 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395553 2:3530923-3530945 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925473852 2:4191578-4191600 CTTTATTAGCAGTGAGAGAATGG - Intergenic
925499917 2:4491037-4491059 CTTTATTAGCAGTGTGAAAACGG + Intergenic
925590225 2:5501909-5501931 CTTTATTAGCAGTGTGAAAATGG + Intergenic
925817142 2:7764567-7764589 CTTTATCAGCAGTGTGAAGATGG - Intergenic
926515350 2:13838008-13838030 CTTTATTAGCAGTGTGAAAACGG + Intergenic
926614127 2:14978121-14978143 TTTTATAAGAAGAGAAAAGAAGG - Intergenic
927239664 2:20910451-20910473 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
927301955 2:21525952-21525974 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
928384046 2:30849036-30849058 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
928485756 2:31729360-31729382 CTTTATTAGCAGTGTGAAAATGG - Intergenic
928795462 2:35013589-35013611 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
928822469 2:35378054-35378076 TTTTATTAGGAGTTAAAAAATGG + Intergenic
929038975 2:37724294-37724316 TTTGATGAGTTGAGAGAAGAAGG + Intronic
929134382 2:38609190-38609212 CTTTATTAGCAGTGTGAAAATGG - Intergenic
929273910 2:40004974-40004996 TTTTACTAGTTATGAGAAGCAGG + Intergenic
929864753 2:45708659-45708681 CTTTATCAGTAGTGTGAAAACGG + Intronic
929958235 2:46477031-46477053 TTTGATGAGTTGAGAGAAGAAGG - Intronic
930044199 2:47154891-47154913 TTTAATTAGTAGTGGGAAGAAGG + Intronic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930317948 2:49820432-49820454 CTTTATCAGCAGTGTGAAGATGG - Intergenic
930365873 2:50438728-50438750 TTTTATTAATAATCAGAAAAGGG + Intronic
930403069 2:50915778-50915800 TTTTATTAATGGTGACAATAAGG - Intronic
930438621 2:51378226-51378248 TTTTATTAGCAGTGTGAGAATGG + Intergenic
930681847 2:54265139-54265161 CTTTATCAGCAGTGAGAAAATGG - Intronic
930922693 2:56776832-56776854 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
931063662 2:58560015-58560037 TTTTATTTTTAGTGATGAGATGG + Intergenic
931194300 2:60036005-60036027 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
931475706 2:62585834-62585856 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
931574684 2:63707611-63707633 TTTGATGAGTTGAGAGAAGAAGG - Intronic
931860701 2:66351865-66351887 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
932043239 2:68321252-68321274 GTTTATGAGTAGTGGAAAGAGGG + Intergenic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
934693483 2:96380120-96380142 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
935450346 2:103201694-103201716 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
935887876 2:107643326-107643348 CTTTATTAGAAGTGTGAAAATGG + Intergenic
936172966 2:110192164-110192186 TTTCATGAGTTGAGAGAAGAAGG + Intronic
936612750 2:114017958-114017980 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
936932573 2:117804803-117804825 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
937008813 2:118543268-118543290 CTTTATTAGCAGTGTGAAAATGG + Intergenic
937754859 2:125524816-125524838 TTATATTAGGTGTGAGAAAAAGG - Intergenic
938156744 2:128948280-128948302 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
938190046 2:129270700-129270722 TTTTAATAGAGGTGACAAGAGGG - Intergenic
938520688 2:132067853-132067875 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
939297482 2:140287537-140287559 TTTTATTAGTTTTGAGAACTTGG - Intronic
939679960 2:145118367-145118389 TTTTATTAGCAGTGTGAGAATGG - Intergenic
939820563 2:146952126-146952148 TTTAATTAGTAGTTAGCATATGG - Intergenic
939871239 2:147528124-147528146 CTTTATCAGTAGTGTGAAAATGG - Intergenic
940218578 2:151326821-151326843 TTTTATTATTAGTGAAAAATGGG - Intergenic
940475152 2:154152915-154152937 TTTGATGAGTTGAGAGAAGAAGG - Intronic
940644336 2:156375245-156375267 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
940949633 2:159658822-159658844 TTTTATTTGTATTGAACAGATGG + Intergenic
941053491 2:160761905-160761927 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
941056859 2:160798476-160798498 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
941075640 2:161003313-161003335 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
941447432 2:165619407-165619429 TTTTATTAGTGGTGAGGCTAAGG + Intronic
941559559 2:167027490-167027512 TTTGATGAGTTGAGAGAAGAAGG - Intronic
941623859 2:167809268-167809290 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
942056827 2:172192252-172192274 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
942440230 2:176027074-176027096 TTTTATTAGTTTTGAAAATAAGG - Intergenic
942466909 2:176217977-176217999 TATTTTTAGTAGTGACAACATGG + Intergenic
942601512 2:177645039-177645061 CTTTATTAGCAGTGTGAAAACGG + Intronic
942715718 2:178889610-178889632 TTTAATTAGTAATGAAATGAGGG + Intronic
942760076 2:179386907-179386929 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
942798585 2:179850239-179850261 TTTTATTAATAATGCCAAGAAGG + Intronic
943031211 2:182687689-182687711 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
943109484 2:183587342-183587364 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
943140584 2:183976579-183976601 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
943549428 2:189320323-189320345 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
943776911 2:191775436-191775458 CTTTATCAGTAATGAGAAAATGG + Intergenic
943908796 2:193535762-193535784 TTTTATTATTATAGATAAGAAGG - Intergenic
943948418 2:194096915-194096937 TTTTATTACTACTCATAAGAAGG + Intergenic
944520890 2:200566056-200566078 TTTGATGAGTGGAGAGAAGAAGG - Intronic
944570064 2:201035586-201035608 TTTGATGAGTTGAGAGAAGAAGG - Intronic
944631693 2:201632772-201632794 CTTTATTAGTAGTGTGAGAACGG + Intronic
945337968 2:208615450-208615472 CTTTATTAGCAGTGTGAAAATGG + Intronic
945343443 2:208685337-208685359 TTTGATGAGTTGAGAGAAGAAGG - Intronic
945352798 2:208801792-208801814 TTTGACGAGTAGAGAGAAGAAGG + Intronic
945360004 2:208885837-208885859 CTTTATCAGTAGTGTGAAAATGG + Intergenic
945447916 2:209960014-209960036 AGTAAATAGTAGTGAGAAGAAGG - Intronic
945873636 2:215254112-215254134 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
946670966 2:222104071-222104093 TTTTATTAAAAATGAAAAGAAGG + Intergenic
947476479 2:230453014-230453036 TTTTATTAGCAGTGTGAGGATGG - Intronic
948008729 2:234633513-234633535 TTTTATGTGAAGTGAGTAGATGG - Intergenic
948120757 2:235528679-235528701 TTTTGTTTGTTTTGAGAAGACGG + Intronic
948279411 2:236735031-236735053 TTTTCTTAGTAGAGAGCAGCAGG - Intergenic
948365907 2:237454562-237454584 GTTTATTAGTAGTGTGAGAATGG - Intergenic
948419557 2:237848440-237848462 TTTGATGAGTTGAGAGAAGATGG - Intergenic
1169294677 20:4384844-4384866 TTTGAAAAGTAGTGAGAAGGAGG + Intergenic
1170360219 20:15537782-15537804 TTGTAAGAGTTGTGAGAAGAAGG - Intronic
1170386733 20:15826965-15826987 TGTCATTATTAGTGAGAATATGG + Intronic
1170483519 20:16792822-16792844 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1170843631 20:19943917-19943939 TTCTATTAGTCTGGAGAAGAAGG - Intronic
1171044400 20:21796953-21796975 TTTTTATAGCAGTGTGAAGAAGG + Intergenic
1171065510 20:22010577-22010599 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1171068689 20:22045443-22045465 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1171075225 20:22115767-22115789 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1171172176 20:23025214-23025236 ATTTTTTAGTAGTGAGATGATGG - Intergenic
1171748429 20:29023082-29023104 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1171786544 20:29471138-29471160 TTTGATGAGTCGAGAGAAGAAGG - Intergenic
1173232100 20:41206302-41206324 TTTGATGAGTTGAGAGAAGAGGG + Intronic
1173306260 20:41852910-41852932 TTTTATTATTATAGAAAAGAGGG + Intergenic
1173491739 20:43488177-43488199 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1173868664 20:46328706-46328728 TTTTGTTAGGACTGAGAGGAGGG - Intergenic
1175026147 20:55905229-55905251 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1175346675 20:58284042-58284064 TTGAATTGGTAGGGAGAAGATGG - Intergenic
1175419178 20:58820578-58820600 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1175546603 20:59782159-59782181 TTTTATCAGCAGTGTGAAAACGG - Intronic
1175793143 20:61754925-61754947 CTTTATCAGTAGTGTGAAAACGG - Intronic
1175883762 20:62276228-62276250 TTTTATCAATAGTGAGCAAATGG + Intronic
1176743792 21:10632232-10632254 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1176858988 21:13994453-13994475 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1176971539 21:15271457-15271479 TTTTATCAGGAGTGTGAAAATGG + Intergenic
1177226894 21:18268590-18268612 CTTTATTAGCAGTAAGAAAATGG + Intergenic
1177281865 21:18991182-18991204 GTTCATTAGTATTGACAAGAAGG + Intergenic
1177285750 21:19047537-19047559 TCTTAATAGTAGTGTGAAAATGG - Intergenic
1177484909 21:21745125-21745147 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1177599642 21:23293951-23293973 TTTTCTTAGTAGGAAGAATATGG + Intergenic
1177611470 21:23454597-23454619 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1178172450 21:30057009-30057031 TTTTATTAGCAGTGTGAGAATGG - Intergenic
1178218571 21:30628936-30628958 TTTTAAAAGTAGTCAGAAAAAGG + Intergenic
1178268250 21:31165351-31165373 ATGTAATAGTAGTTAGAAGAGGG + Intronic
1178468858 21:32874132-32874154 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1178990547 21:37351646-37351668 TCTTATTTCTAGTGAGATGAAGG + Intergenic
1179037666 21:37773441-37773463 TCTTATGAGTAGGGAGCAGAGGG + Intronic
1179178606 21:39026572-39026594 TTTTATTCTTCGTGAGAAGGGGG + Intergenic
1179301064 21:40110573-40110595 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1179527808 21:41995084-41995106 CTTTATTAGAAGTGTGAAAATGG + Intronic
1180458516 22:15536036-15536058 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1182162266 22:28134366-28134388 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1182510059 22:30813122-30813144 TTTTAGTAGTAGGGGGAAAATGG + Intronic
1183022386 22:35037844-35037866 CTTTATTATTAGTGTGAAAACGG - Intergenic
949209310 3:1478624-1478646 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
949259936 3:2093818-2093840 CTTTATTAGAAGTGTGAAAATGG + Intergenic
949308609 3:2671574-2671596 TTTGATGAGTTGAGAGAAGAAGG - Intronic
949342634 3:3045785-3045807 TTTGATGAGTTGAGAGAAGAAGG + Intronic
949662017 3:6290891-6290913 CTTTATTAGCAGTGTGAAAATGG - Intergenic
949689711 3:6621631-6621653 TTTTATTAGCTTTGAGAAAAAGG + Intergenic
950781463 3:15396474-15396496 TTTGATGAGTTGAGAGAAGAAGG - Intronic
950792532 3:15484883-15484905 TTTGATGAGTTGAGAGAAGAAGG - Intronic
950862636 3:16163836-16163858 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
950919328 3:16677765-16677787 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
951330863 3:21365996-21366018 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
951482984 3:23181375-23181397 TTTCATTAGTATTGTGAAGATGG - Intergenic
951493664 3:23301268-23301290 TTTGATTAGTTGAGAGAAGAAGG - Intronic
951497890 3:23350393-23350415 TTTGATGAGTTGAGAGAAGAAGG + Intronic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
951902322 3:27668964-27668986 TGTTCTTAGTGGTGAGAAGTTGG + Intergenic
951936286 3:28026073-28026095 CTTTATTAGCAGTGTGAAAATGG + Intergenic
952195611 3:31072690-31072712 CTTTATTAGCAGTGTGAAAATGG + Intergenic
952204917 3:31171503-31171525 TTGTATTATTGGTGACAAGAGGG + Intergenic
952515058 3:34095217-34095239 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
952666495 3:35911183-35911205 TTTTATTAATAGCCAGAATATGG - Intergenic
952677778 3:36053673-36053695 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
953354093 3:42239641-42239663 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
953378135 3:42445959-42445981 TTTTAATAGCAGTGTGAAAATGG + Intergenic
953899064 3:46828794-46828816 TTGTATTTTTAGTGAAAAGACGG + Intergenic
954170246 3:48795895-48795917 TTTTTTTACTGGTGAGAAGGGGG + Intronic
954488542 3:50878278-50878300 TTTGATGAGTTGAGAGAAGAAGG + Intronic
954534196 3:51346062-51346084 TTTTATTAGTATTGAGAAGTTGG + Intronic
954548257 3:51457070-51457092 TTTGATGAGTTGAGAGAAGAAGG + Intronic
955039003 3:55296759-55296781 CTTTATTAGTAGTGTGAGAATGG - Intergenic
955048950 3:55389865-55389887 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
955172510 3:56581399-56581421 TTTGATGAGTTGAGAGAAGAAGG - Intronic
955282539 3:57607398-57607420 TTTGATGAGTTGGGAGAAGAAGG + Intergenic
955457668 3:59141790-59141812 CTTTATTAGTGGTGAGAAAATGG + Intergenic
955826168 3:62950563-62950585 CTTTATTAGCAGTGATAAAACGG + Intergenic
956038528 3:65121027-65121049 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
956225380 3:66951701-66951723 TGTTATTAGTACTTAGAAGCAGG + Intergenic
956242827 3:67148792-67148814 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
956448172 3:69345989-69346011 TTTGATGAGTTGAGAGAAGAAGG + Intronic
956558913 3:70551956-70551978 CTTTATTAGCAGTGTGAAAATGG - Intergenic
957061797 3:75488449-75488471 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
957101717 3:75836742-75836764 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
957487900 3:80886747-80886769 CTTTATTAGTAGTGTGAGAACGG - Intergenic
957638785 3:82821578-82821600 ATTTATAAATATTGAGAAGAGGG - Intergenic
957840972 3:85668764-85668786 ATTTATCAGCAGTGTGAAGATGG + Intronic
957857439 3:85895950-85895972 CTTTATTAGTAGTGTGAGAATGG + Intronic
957942094 3:87018250-87018272 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
958096950 3:88958264-88958286 TCTTATTAGGAGTGAAATGAGGG + Intergenic
958166525 3:89884414-89884436 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
958176044 3:89997116-89997138 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
958410248 3:93807452-93807474 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
958593841 3:96196067-96196089 TTTTATTAGTAACTAGAAGAAGG - Intergenic
958624404 3:96606324-96606346 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
958769350 3:98407730-98407752 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
958861593 3:99451183-99451205 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
959504807 3:107145237-107145259 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
959624181 3:108431606-108431628 TTTTATCAGCAGTGTGAAAACGG + Intronic
959823996 3:110771126-110771148 TTTTATGAGTACCCAGAAGAAGG + Intergenic
959953825 3:112212363-112212385 TTTGATGAGTTGAGAGAAGAAGG + Intronic
960061132 3:113322807-113322829 TTTTATTAGCAGTGTGAGAATGG - Intronic
960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG + Intergenic
960292366 3:115901036-115901058 TTTGCTTAGTAGTGAGTAGCAGG + Intronic
960448681 3:117779123-117779145 TTTGATGAGTGGAGAGAAGAAGG + Intergenic
960486664 3:118260366-118260388 CTTTATCAGTAGTGTGAACATGG + Intergenic
960535437 3:118809867-118809889 TTTTATCAGCAGTGTGAAAATGG - Intergenic
961174802 3:124825886-124825908 TTTTATTAATAGTGAGAAAAAGG + Intronic
961291613 3:125850954-125850976 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
961420890 3:126802221-126802243 TTTGATGAGTTGAGAGAAGAAGG + Intronic
962178003 3:133174833-133174855 TTTGATGAGTTGAGAGAAGAAGG + Intronic
962180265 3:133199271-133199293 TTTGATGAGTTGAGAGAAGAAGG - Intronic
962439781 3:135402763-135402785 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
962576802 3:136762456-136762478 TTTTATCAGCAGTGTGAAAATGG + Intergenic
962643611 3:137413625-137413647 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
962657070 3:137557925-137557947 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
962690962 3:137897749-137897771 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
962836648 3:139195631-139195653 TTTGATGAGTTGAGAGAAGAAGG - Intronic
962883539 3:139601535-139601557 TGTTATTTGTAGTGAAAACAAGG - Intronic
962987575 3:140549552-140549574 TTTAATTTGTTGTGAGAAGTAGG - Intronic
962987736 3:140551007-140551029 TTTAATTTGTTGTGAGAAGTAGG - Intronic
963070376 3:141300523-141300545 TTTGACGAGTAGAGAGAAGAAGG - Intergenic
963149910 3:142034680-142034702 TTGTAATAGTATTAAGAAGATGG - Intronic
963475253 3:145795711-145795733 CTTTATCAGTAGTGTGAAAACGG - Intergenic
963581246 3:147129193-147129215 TTTGATGAGTTGAGAGAAGAGGG - Intergenic
963952724 3:151220786-151220808 TTTTATCAGCAGTGTGAAAACGG + Intronic
964076531 3:152699745-152699767 TTTTATCAGCAGTGTGAAAATGG - Intergenic
964100379 3:152981348-152981370 TTTGATGAGTAGCGAGAAGAAGG + Intergenic
964125968 3:153233777-153233799 TTTTATTGGAAGAGATAAGAAGG + Intergenic
964156019 3:153585127-153585149 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
964781196 3:160340203-160340225 TTTTTTTATCAGTAAGAAGAAGG + Intronic
964898830 3:161632250-161632272 TTTTATTTGTAGAGATAAGAGGG + Intergenic
964969817 3:162545727-162545749 CTTTATTAATAGTGGGTAGAAGG - Intergenic
966150503 3:176862432-176862454 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
966285289 3:178288126-178288148 CTTTATTAGCAGTGTGAAAATGG - Intergenic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
966744758 3:183264976-183264998 TTCTATTTGGACTGAGAAGAAGG - Intronic
966982186 3:185147857-185147879 TTTCATTATTATGGAGAAGAGGG - Intronic
967078448 3:186026364-186026386 TCTTATTAGCAGTGTGAAAAGGG + Intergenic
967248609 3:187513843-187513865 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
967469153 3:189842638-189842660 TTTAATCAGCACTGAGAAGAGGG + Intronic
967762308 3:193240491-193240513 TTTTTTTAGCAGTGAGAAAAAGG + Intergenic
968272138 3:197411063-197411085 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
969865553 4:10074949-10074971 TTTCTGTACTAGTGAGAAGAGGG - Exonic
970020167 4:11558594-11558616 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
970896335 4:21108582-21108604 TTTGATAAGTTGAGAGAAGATGG - Intronic
970983087 4:22124152-22124174 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
971543492 4:27853334-27853356 TTTTATTAGCAGAGATATGAAGG - Intergenic
971593850 4:28502273-28502295 CTTTATTAGCAGTGTGAAAATGG - Intergenic
971705610 4:30038742-30038764 CTTTATTAGCAGTGTGAAAATGG - Intergenic
971994841 4:33952439-33952461 TTTTGTTTGTGTTGAGAAGAAGG - Intergenic
972332389 4:38076054-38076076 TTTTATTAGCAGTGTGAGAACGG - Intronic
972756777 4:42056294-42056316 TTTTATCAGCAGTGTGAAAATGG - Intronic
972771536 4:42202026-42202048 CTTTATCAGTAGTGTGAAAATGG - Intergenic
972965221 4:44501407-44501429 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
972984637 4:44748979-44749001 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
972985724 4:44762201-44762223 GTTTAATAGCAGAGAGAAGATGG + Intergenic
973564435 4:52170197-52170219 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
973731614 4:53828616-53828638 TTTGATGAGTTGAGAGAAGAAGG - Intronic
973859052 4:55042434-55042456 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
973923083 4:55708795-55708817 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
973935597 4:55842887-55842909 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
974112018 4:57536834-57536856 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
974176775 4:58334469-58334491 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
974367936 4:60976235-60976257 TTTGATGACTTGTGAGAAGAAGG + Intergenic
974427468 4:61759655-61759677 TTTGATGAGTTGAGAGAAGAAGG - Intronic
974470315 4:62310400-62310422 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
974515341 4:62900906-62900928 TTGTGTTAGTAGTGAGAGAAGGG + Intergenic
974536605 4:63182887-63182909 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
974846190 4:67353317-67353339 TCCTATGAGTAGGGAGAAGATGG + Intergenic
974861987 4:67533398-67533420 TTTTATCAGCAGTGTGAAAATGG + Intronic
974956245 4:68645214-68645236 TTTGATGAGTTGAGAGAAGAAGG - Intronic
974959709 4:68682513-68682535 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
975034356 4:69661951-69661973 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
975200355 4:71581185-71581207 GTTTATTAGCAGTGTGAAAATGG - Intergenic
975277535 4:72519822-72519844 TTTGATGAGTTGAGAGAAGAAGG - Intronic
975295692 4:72731520-72731542 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
975352525 4:73361289-73361311 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
975400759 4:73936568-73936590 TTTTAATATTAGTTAGCAGATGG - Intergenic
975887301 4:78981428-78981450 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
976291120 4:83418798-83418820 CTTTCTTAGTAGTCACAAGATGG - Intronic
976857878 4:89626697-89626719 TTTCATTAGTAAGAAGAAGAGGG - Intergenic
976918613 4:90408789-90408811 TTTGATGAGTTGAGAGAAGAAGG + Intronic
976968772 4:91078580-91078602 TTTGATGAGTCGAGAGAAGAAGG + Intronic
977053843 4:92164174-92164196 CTTTATCAGCAGTGTGAAGATGG - Intergenic
977218726 4:94314123-94314145 TTTGATGAGTTGAGAGAAGAAGG - Intronic
977321170 4:95518233-95518255 ATTTATTTGGAGTGAGAAAATGG - Intronic
977516105 4:98023001-98023023 TTTGATGAGTTGAGAGAAGAAGG - Intronic
977580973 4:98724422-98724444 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
977680880 4:99797617-99797639 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
978047489 4:104149480-104149502 TCTGATCAGTAGTAAGAAGAAGG - Intergenic
978632404 4:110762463-110762485 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
978680876 4:111379062-111379084 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
979042230 4:115812816-115812838 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
979074662 4:116256890-116256912 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
979097953 4:116574502-116574524 TTTTATTAGTAGGGTGAAAATGG - Intergenic
979175642 4:117659187-117659209 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
979177032 4:117678411-117678433 CTTTATTAGCAGTGGGAAAATGG + Intergenic
979426212 4:120571183-120571205 CTTTATTAGCAGTGTGAAAATGG - Intergenic
979472921 4:121122664-121122686 TTTTATTACTATTGAGGAGAGGG + Intergenic
979560063 4:122091578-122091600 TTTGATTAGTTGTGAGAAGGAGG - Intergenic
979560458 4:122096099-122096121 TTTTATCAGCAGTGTGAAAATGG - Intergenic
979689529 4:123546080-123546102 TTTTGTTAGCAGAGAGAAGTTGG - Intergenic
979739372 4:124130799-124130821 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
979805904 4:124970869-124970891 TTTTATCAGCAGTGTGAAAATGG + Intergenic
979808517 4:125005355-125005377 TTTTGTTAGTAGTTGGAGGAGGG - Intergenic
979856309 4:125638076-125638098 CTTTATCAGTAGTGTGAAAATGG - Intergenic
980205997 4:129720468-129720490 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
980217881 4:129875724-129875746 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
980483664 4:133424739-133424761 TTGTCTTAGTAGTCAGATGAAGG + Intergenic
980638124 4:135536216-135536238 TTCTATGATTAGTGATAAGATGG - Intergenic
981068454 4:140509336-140509358 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
981149745 4:141367693-141367715 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
981151007 4:141378925-141378947 TTTGATGAGTTGAGAGAAGACGG + Intergenic
981165328 4:141550455-141550477 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
981387878 4:144152889-144152911 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
981418920 4:144526610-144526632 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
981618226 4:146664632-146664654 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
981684239 4:147435170-147435192 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
981687446 4:147470784-147470806 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
982279298 4:153667121-153667143 CTTTATTAGCAGTGTGAAAATGG + Intergenic
982310750 4:153983060-153983082 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
982392754 4:154883891-154883913 CTTTATTAGCAGTGTGAAAATGG - Intergenic
982554921 4:156848780-156848802 TTATATTTGCAGTGACAAGAAGG + Intronic
982817418 4:159904091-159904113 TTTGATTAGTAGTATGATGATGG - Intergenic
982890141 4:160837061-160837083 TTTAATTAGTGGGGATAAGAGGG - Intergenic
983148126 4:164242635-164242657 TTTGATGAGCTGTGAGAAGAAGG + Intronic
983292132 4:165820035-165820057 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
983305392 4:165978277-165978299 TTTTTTTATTAGTGAGAAAGAGG + Intronic
983668408 4:170208228-170208250 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
984010348 4:174363811-174363833 CTTTATTAGCAGTGTGAAAATGG - Intergenic
984168105 4:176327097-176327119 TTTAATTTGAAGTGATAAGATGG + Intronic
984320743 4:178192576-178192598 ATTTGGTGGTAGTGAGAAGAGGG + Intergenic
984472047 4:180188975-180188997 CTTTATTAGTAGTGTGAGAACGG - Intergenic
984749692 4:183260157-183260179 TTTTATTTTTAGAGAAAAGAAGG - Intronic
984975183 4:185223828-185223850 ATTTATTAGGAGTGACAAGATGG + Intronic
985798802 5:1987462-1987484 TTTTAATAGCAGTGTGAAAAAGG + Intergenic
986780112 5:11057594-11057616 CTTTATCAGCAGTGAGAAAATGG + Intronic
986953204 5:13116248-13116270 CTTTATTAGTAGTGTGACAATGG + Intergenic
987216685 5:15744707-15744729 CTTTATTAGTAGTGTGAGAATGG - Intronic
987467093 5:18284975-18284997 TTTTATCAGCAGTGTGAAAACGG - Intergenic
987544935 5:19302737-19302759 TTTTATTAGCAGTGTGAGAATGG - Intergenic
987567647 5:19613543-19613565 TTATCTTAGTAGTGCAAAGAGGG + Intronic
987655626 5:20801430-20801452 CTTTATCAGTAGTGTGAATATGG + Intergenic
987737538 5:21866192-21866214 TTTTATTGGCAGTGTGAAAAAGG + Intronic
987785677 5:22495374-22495396 TATTATTAAAAGTGAGAAAATGG + Intronic
987853594 5:23388675-23388697 TTTTATTTGTACTTAGAAAAGGG - Intergenic
987878017 5:23706122-23706144 TTTTCTTAGTTGTGAGATTATGG - Intergenic
988014632 5:25538066-25538088 TTTGATTAGTGGAGAGAAAAAGG - Intergenic
988325738 5:29764882-29764904 TTTTATATGTAATGAGAAGTAGG + Intergenic
988660506 5:33262258-33262280 TTTTATTAGCAGTGTAAAAATGG - Intergenic
988690793 5:33569753-33569775 TTTGATGAGTTGAGAGAAGAAGG + Intronic
988767928 5:34402463-34402485 CTTTATCAGTAGTGTGAATATGG - Intergenic
988773514 5:34454619-34454641 CTTTATTAGCAGTGAGAGAACGG - Intergenic
988880383 5:35495389-35495411 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
988885895 5:35558092-35558114 CTTTATCAGTAGTGTGAAAATGG - Intergenic
989402498 5:41023199-41023221 TTTGATGAGTTGAGAGAAGAAGG + Intronic
989608109 5:43265610-43265632 TTTGATGAGTTGAGAGAAGAAGG - Intronic
989739691 5:44756036-44756058 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
989768673 5:45116807-45116829 TTTGATGAGTGGAGAGAAGAAGG - Intergenic
989787403 5:45347522-45347544 TTTGATGAGTTGAGAGAAGAAGG + Intronic
989940721 5:50146598-50146620 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
989942771 5:50173794-50173816 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
989946103 5:50231250-50231272 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
989968084 5:50488968-50488990 TTTGACGAGTAGAGAGAAGAGGG - Intergenic
990127313 5:52534382-52534404 TTTGATTACTTGAGAGAAGAAGG + Intergenic
990325920 5:54675198-54675220 TTTTAGTAGTAATGAGGACAAGG + Intergenic
990360516 5:55013991-55014013 TTTGATGAGTTGAGAGAAGAAGG + Intronic
990366860 5:55080346-55080368 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
991042011 5:62185891-62185913 TTCTATTACTAGTGAGAAAATGG + Intergenic
991097417 5:62753532-62753554 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
991108004 5:62864298-62864320 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
991285803 5:64974286-64974308 TTTTATCAGCAGTGTGAAAATGG - Intronic
991478913 5:67055517-67055539 TTATATTACTGGGGAGAAGAAGG + Intronic
992235819 5:74707449-74707471 TTTGATGAGTTGAGAGAAGAAGG + Intronic
992354672 5:75968333-75968355 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
992467638 5:77022820-77022842 CTTTATCAGCAGTGAGAAAACGG + Intergenic
992634180 5:78710893-78710915 TTTGATGAGTTGAGAGAAGAAGG + Intronic
992659416 5:78944262-78944284 TTTGATGAGTTGAGAGAAGAAGG - Intronic
992681105 5:79153997-79154019 ATTTCTTAGGAGTGGGAAGATGG - Intronic
992755723 5:79903445-79903467 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
992815073 5:80428613-80428635 TTTGATGAGTTGAGAGAAGAAGG + Intronic
992873603 5:81029801-81029823 TTTGATGAGTTGAGAGAAGAAGG + Intronic
993008710 5:82456525-82456547 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
993065107 5:83088701-83088723 TTTTCTTATTAGGGAGAAGCTGG - Intronic
993065194 5:83089680-83089702 TTTTCTTATTAGGGAGAAGCTGG + Intronic
993267203 5:85741090-85741112 TTTTAATAGCAGTGTGAAAATGG - Intergenic
993341528 5:86730817-86730839 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
993446111 5:88014454-88014476 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
993638093 5:90370209-90370231 CTTTATTAGCAGTGTGAAAATGG - Intergenic
993742361 5:91556519-91556541 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
993917666 5:93762208-93762230 TTTGATGAGTTGAGAGAAGAAGG + Intronic
993925033 5:93855972-93855994 TTTGATGAGTTGAGAGAAGAAGG + Intronic
993925102 5:93856766-93856788 TTTGATGAGTTGAGAGAAGAAGG - Intronic
994224721 5:97239252-97239274 TTTGATGAGTAGAGAGAAGAAGG - Intergenic
994263200 5:97684241-97684263 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
994290512 5:98023752-98023774 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
994387329 5:99147345-99147367 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
994474696 5:100251739-100251761 TAGAATTAGTAATGAGAAGAGGG - Intergenic
994492332 5:100463126-100463148 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
994565734 5:101443190-101443212 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
994664165 5:102688410-102688432 TTTGACAAGTAGAGAGAAGAAGG - Intergenic
994801369 5:104381240-104381262 CTTTATTAGCAGTGTGAAAATGG - Intergenic
994973721 5:106775964-106775986 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
995155849 5:108912190-108912212 CTTTATTAGCAGTGTGAAAACGG + Intronic
995255829 5:110045351-110045373 TGATCTTAGTAGTGAGAAGCTGG - Intergenic
995692761 5:114845559-114845581 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
995771525 5:115675666-115675688 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
995905358 5:117116775-117116797 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
996114257 5:119600469-119600491 TTTGATGAGTTGAGAGAAGAAGG + Intronic
996130864 5:119779748-119779770 TTTGATGAGCTGTGAGAAGAAGG - Intergenic
996401273 5:123065796-123065818 CTTTATCAGTAGTGTGAAAATGG - Intergenic
996444703 5:123533540-123533562 TTTTATTATTAGTTGGAAGTTGG + Intronic
996958825 5:129218932-129218954 TTTTGTTAGTAGTAAGTAGTAGG - Intergenic
996964318 5:129290215-129290237 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
997056781 5:130453001-130453023 CTTTATCAGTAGTGTGAAAATGG - Intergenic
997117147 5:131137902-131137924 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
997274738 5:132575116-132575138 CTTTATTAGCAGTGTGAAAACGG - Intronic
997578543 5:135002937-135002959 TTTGATGAGTTGAGAGAAGAAGG - Intronic
997797737 5:136827997-136828019 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
998343075 5:141434756-141434778 TTTTTTTAGAAGTGTGAAGTGGG - Intronic
998699766 5:144684820-144684842 CTTTATTAGCAGTGTGAAAATGG - Intergenic
998746464 5:145265441-145265463 TTTTTCTAGTTGTGTGAAGAAGG - Intergenic
999473896 5:151880160-151880182 CTTTATTAGCAGTGTGAAAATGG + Intronic
999605034 5:153305417-153305439 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1000412218 5:160946075-160946097 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1000522725 5:162318105-162318127 CTTTATCAGGAGTGTGAAGATGG + Intergenic
1001807302 5:174598494-174598516 CTTTATTTTCAGTGAGAAGAAGG - Intergenic
1002657398 5:180761653-180761675 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1003154775 6:3582333-3582355 TTTCATTCTTAATGAGAAGAGGG - Intergenic
1004730958 6:18358762-18358784 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1004830956 6:19476203-19476225 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1005578062 6:27208456-27208478 TTATATTTTTAGTGACAAGAAGG + Intergenic
1006465094 6:34188800-34188822 ATTTATTAGTAGTTGGAAGGCGG - Intergenic
1006583808 6:35092386-35092408 TTTTATTGGTAGAGAAAACAAGG + Intergenic
1006687528 6:35848819-35848841 TTGTATTCGGAGTGAGATGAGGG - Intronic
1007845209 6:44748594-44748616 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1007945851 6:45826352-45826374 TTCTACAAGTAGTGAGAATAAGG - Intergenic
1008239994 6:49098517-49098539 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1008302373 6:49856854-49856876 TTTAATTATTAGTGAGATTAAGG + Intronic
1008338981 6:50341798-50341820 TTTTTTTATTATTGATAAGATGG - Intergenic
1008339285 6:50344870-50344892 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1008398423 6:51036381-51036403 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1008566687 6:52776214-52776236 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1008649979 6:53552036-53552058 TTTTATCAGCAGTGTGAAGATGG + Intronic
1008671670 6:53775171-53775193 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1008687334 6:53940267-53940289 CTTTATTAGCAGTGTGAAAATGG + Intronic
1008828200 6:55725127-55725149 GCTTATGAGTAGTGAGAGGAAGG + Intergenic
1008829147 6:55736679-55736701 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1008999973 6:57701555-57701577 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1009188446 6:60600972-60600994 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1009300181 6:62008922-62008944 CTTTATCAGTAGTGTGAAAACGG + Intronic
1009382892 6:63054057-63054079 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1009410495 6:63360639-63360661 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1009490620 6:64285629-64285651 TTTTATTAATAGTGTGAAAATGG - Intronic
1009780147 6:68259445-68259467 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1009826901 6:68878722-68878744 TTTTATCAGTAGTGTGAAAATGG - Intronic
1009870211 6:69444525-69444547 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1010105522 6:72163369-72163391 TTTGATGAGTCGAGAGAAGAAGG - Intronic
1010275838 6:73967457-73967479 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1010279897 6:74012155-74012177 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1010352224 6:74888260-74888282 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1010361923 6:75004843-75004865 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1010511718 6:76728873-76728895 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1010879730 6:81152944-81152966 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1010913916 6:81592105-81592127 TTTTATATGTAGTGAGAGGTAGG + Intronic
1010944416 6:81958015-81958037 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1010993025 6:82501421-82501443 TTTAATGAGTTGAGAGAAGAAGG - Intergenic
1011070697 6:83379031-83379053 TTTTATTAGTGTTGAAAATAAGG - Intronic
1011302983 6:85895955-85895977 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1011349121 6:86402841-86402863 TCTTATTAGCAGTGTGAAAATGG - Intergenic
1011408160 6:87038175-87038197 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1011533638 6:88351965-88351987 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1011550303 6:88526190-88526212 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1011760825 6:90563222-90563244 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1011834955 6:91420613-91420635 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1011949973 6:92953014-92953036 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1012082414 6:94777615-94777637 GTGTTTTAGTAGTGAGCAGAAGG + Intergenic
1012141391 6:95630778-95630800 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1012247673 6:96943848-96943870 TTTTATAATTACTGAAAAGAAGG + Intronic
1012417870 6:99029244-99029266 TTTTATTAGTAAACAGGAGAAGG + Intergenic
1012716408 6:102678289-102678311 CTTTATGAATAGGGAGAAGATGG - Intergenic
1012749822 6:103144548-103144570 CTTTATTAGCAGTGTGAAAAAGG - Intergenic
1013328902 6:109078052-109078074 ATTTATTATTATAGAGAAGAGGG - Intronic
1013906270 6:115223217-115223239 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1014255026 6:119152399-119152421 ATTTATTAGTAAGAAGAAGATGG + Intergenic
1014650700 6:124033357-124033379 TGTTATAATTAGTAAGAAGAGGG - Intronic
1014765124 6:125397241-125397263 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1014849852 6:126327747-126327769 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1015045039 6:128767114-128767136 TTTTATTAGCAGTGTGAGAATGG - Intergenic
1015105842 6:129535791-129535813 TTTTAATACTAGTGCAAAGATGG - Intergenic
1015367938 6:132418173-132418195 GTTTATTAGTAGTGTGAAAATGG - Intergenic
1015430222 6:133122642-133122664 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1015518493 6:134108486-134108508 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1016161414 6:140885243-140885265 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1016164698 6:140926169-140926191 TTTTCTTAGTTGAAAGAAGAAGG + Intergenic
1016333778 6:142982388-142982410 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1016625386 6:146161014-146161036 TTCTTTTAGGAGTGAAAAGAAGG + Intronic
1016874877 6:148854886-148854908 CTTTATCAGTAGTGTGAAAATGG - Intronic
1016982010 6:149862913-149862935 TTTTATAAAAAGTGAAAAGAGGG - Intronic
1017134176 6:151133762-151133784 TATTATTATTATTGAGACGAGGG - Intergenic
1017204643 6:151791511-151791533 CTTTATTAGCAGTGTGAAAATGG + Intronic
1017424635 6:154307472-154307494 TTTTATCAGCAGTGTGAAAACGG + Intronic
1018114078 6:160565678-160565700 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1018272127 6:162091730-162091752 TTTTATCAGTAGAAAGAAAAAGG + Intronic
1018396759 6:163383751-163383773 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1018760076 6:166885965-166885987 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1018843552 6:167537316-167537338 TTTCATAATTAGAGAGAAGAAGG - Intergenic
1020326256 7:6976871-6976893 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1020339326 7:7092504-7092526 TTTTTTTTATAGTGAAAAGAAGG - Intergenic
1020372776 7:7452377-7452399 TTTTCTTACTAGGGAGAAGTAGG - Exonic
1020582526 7:10022177-10022199 TCTTATCAGTATTGAGCAGATGG + Intergenic
1020611995 7:10409448-10409470 TATTATTAGAAGTGAGGACAGGG + Intergenic
1020619679 7:10502094-10502116 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1020711334 7:11609222-11609244 TTTTATTCTTTGTGAGAAGCTGG - Intronic
1020958681 7:14775800-14775822 TTCTATTAGTAGTGTGAGAATGG + Intronic
1020958935 7:14777712-14777734 CTTTATTAGTAGTGTGACAATGG + Intronic
1021188932 7:17597972-17597994 TTTTCATAGTAACGAGAAGAGGG - Intergenic
1021346200 7:19531866-19531888 TTTTATATGTAGTGAAAGGAAGG + Intergenic
1021373762 7:19882626-19882648 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1021673224 7:23053759-23053781 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1021744142 7:23722066-23722088 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1021750461 7:23794455-23794477 TTTTATTAGTGGTGTGAGAAGGG + Intronic
1021867242 7:24970528-24970550 TTATATAAGTAGAGAAAAGATGG + Intronic
1023005567 7:35862272-35862294 TTTTATTTGTGGTGAGGAGTGGG - Intronic
1023794141 7:43778127-43778149 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1024440787 7:49415284-49415306 TTTTATTACTATTGATAATAAGG + Intergenic
1024445038 7:49467365-49467387 TCTTAATATTACTGAGAAGAGGG - Intergenic
1024717974 7:52102197-52102219 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1025217951 7:57075919-57075941 TTTTATTGGTGGTGAGGAGTGGG + Intergenic
1025595054 7:62913842-62913864 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1025628868 7:63249556-63249578 TTTTATTTGTGGTGAGGAGTGGG + Intergenic
1025653395 7:63494538-63494560 TTTTATTGGTGGTGAGGAGTGGG - Intergenic
1026241614 7:68580518-68580540 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026589830 7:71684984-71685006 TATTATTATTAATGAGAACATGG + Intronic
1027496070 7:78888886-78888908 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1027556633 7:79671429-79671451 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1027792473 7:82650996-82651018 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1027871724 7:83716372-83716394 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1028159174 7:87466056-87466078 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1028395412 7:90364119-90364141 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1028484501 7:91343109-91343131 TTTTATAAATAGTTAGAAAAGGG + Intergenic
1028643735 7:93072796-93072818 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1028680092 7:93517920-93517942 TTATATTGGTAGGGACAAGATGG + Intronic
1028836527 7:95380359-95380381 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1028909418 7:96191041-96191063 TATTATTATTAGGGTGAAGAAGG - Intronic
1029036930 7:97532354-97532376 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1029140909 7:98409271-98409293 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1029325319 7:99802603-99802625 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1029510168 7:100989417-100989439 TTTTATCAGCAGTGTGAAAATGG + Intronic
1030466487 7:109909222-109909244 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1030699370 7:112621822-112621844 TTTTATTATTATTAAGAAGATGG + Intergenic
1030762011 7:113363981-113364003 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1030784380 7:113641767-113641789 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1030786802 7:113672269-113672291 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1030817626 7:114056075-114056097 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1031046852 7:116900101-116900123 TTTTATTTTTAATGAGAAAATGG - Intronic
1031314502 7:120239815-120239837 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1031552475 7:123132224-123132246 TTTTATTAGTAGTGAGAAGATGG - Intronic
1031638560 7:124132967-124132989 TGTTATTAGTCCTGAGAAGCAGG + Intergenic
1031841587 7:126747623-126747645 TTTTGTTAGTAATGAGAATAAGG - Intronic
1031964948 7:128020971-128020993 TTTCATTAGAAATGAGGAGAGGG - Intronic
1032454201 7:132059456-132059478 CTTTATCAGCAGTGTGAAGATGG + Intergenic
1033623941 7:143089427-143089449 TTTGATGAGTCGAGAGAAGAAGG + Intergenic
1033844683 7:145417942-145417964 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1033995536 7:147341628-147341650 TTTTATTAGCATTGAGAAATTGG + Intronic
1034028720 7:147737006-147737028 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1034761441 7:153675531-153675553 TTTCATTAGAATTGAGAAAATGG + Intergenic
1035900594 8:3455296-3455318 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1036166013 8:6434345-6434367 GTTTATGAGTAGTGAGATGAAGG - Intronic
1036571408 8:9982811-9982833 TTTTATTAGCAGTGTGAGAACGG + Intergenic
1036917364 8:12817075-12817097 TTTGTCTAGTAGAGAGAAGAAGG - Intergenic
1037184615 8:16047700-16047722 CTTTATTAGTAGCAAGAAAATGG - Intergenic
1038814307 8:30885536-30885558 CTTTATCAGTAGTGTGAAAATGG + Intronic
1039707329 8:40021381-40021403 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1040070982 8:43188635-43188657 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1040097308 8:43458918-43458940 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1040273528 8:45985006-45985028 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1040364731 8:46704247-46704269 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1040390042 8:46941854-46941876 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1040390240 8:46943302-46943324 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1040431925 8:47351349-47351371 TTTTAAAAGCAGTGTGAAGAAGG + Intronic
1040651051 8:49449052-49449074 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1040736297 8:50512900-50512922 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1040741225 8:50578860-50578882 CTTAATTAGCAGTGTGAAGATGG + Intronic
1040962328 8:53048130-53048152 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1040992819 8:53370142-53370164 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1041161669 8:55050996-55051018 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1041168627 8:55117211-55117233 CTTTTTGAGGAGTGAGAAGAGGG + Intronic
1041295758 8:56356186-56356208 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1041314988 8:56551453-56551475 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1041347349 8:56913327-56913349 TTTTATACGTGTTGAGAAGATGG - Intergenic
1041387575 8:57320254-57320276 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1041772093 8:61482354-61482376 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1041825678 8:62094242-62094264 CTTTATTAGTAGTGTGAGAATGG - Intergenic
1041873320 8:62660025-62660047 CTTTATCAGTAGTGTGAAAATGG + Intronic
1042394622 8:68277444-68277466 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1042707950 8:71681428-71681450 TTTGAGTAGAAGGGAGAAGATGG - Intergenic
1042710742 8:71714149-71714171 TTTTATTAGCAGTATGAAAATGG + Intergenic
1042720468 8:71821404-71821426 TTTAATGAGTTGAGAGAAGAAGG + Intergenic
1042773067 8:72399774-72399796 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1042992242 8:74654710-74654732 CTTTATTAGCAGTGTGAAAATGG + Intronic
1043718703 8:83516284-83516306 TATTTATAGTAGAGAGAAGAAGG - Intergenic
1043739007 8:83784581-83784603 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1043861512 8:85322574-85322596 TTGTATTAATAGTGAACAGATGG + Intergenic
1044183102 8:89219332-89219354 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1044195817 8:89375058-89375080 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1044203064 8:89458673-89458695 TTTGATGAGTGGAGAGAAGAAGG + Intergenic
1044221331 8:89673280-89673302 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1044272681 8:90265255-90265277 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1044540238 8:93400503-93400525 TTTTTTTAGAAATGAGAAGCAGG + Intergenic
1045249455 8:100471229-100471251 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1045259974 8:100563867-100563889 TTTTCTTATTAGGGATAAGAAGG + Intergenic
1045293545 8:100853465-100853487 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1045340255 8:101247726-101247748 TTTTTATATTAGTGAGAAGGAGG + Intergenic
1045370722 8:101519812-101519834 GATTATTAGCAGTGAGTAGATGG - Intronic
1045419639 8:102001033-102001055 TTTGATGAGTAGAGAGAAGAAGG + Intronic
1045784571 8:105905158-105905180 TTTTGTTATTATTGAGAAGAGGG - Intergenic
1045794307 8:106024458-106024480 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1045969162 8:108060191-108060213 TTTGACTAGTTGAGAGAAGAAGG + Intronic
1046364186 8:113204797-113204819 CTTTATTAGCAGTGTGAAAATGG - Intronic
1046404708 8:113757712-113757734 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1046508772 8:115171938-115171960 CTTTATTAGTAGTGTGAGGATGG - Intergenic
1046805965 8:118479289-118479311 TTTTATCAGCAGTGTGAAAATGG - Intronic
1046879598 8:119293184-119293206 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1047035636 8:120935615-120935637 CTTTATTAGTAGTGTGAGAATGG + Intergenic
1047046155 8:121055674-121055696 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1047835928 8:128691012-128691034 TTTTATAAGTTGTGAGAATCTGG + Intergenic
1047942521 8:129839183-129839205 ATTTATTAGTAGTGTGCAAATGG + Intergenic
1047984691 8:130220677-130220699 TTTTATTAGCAGTGTGAGAACGG - Intronic
1048090605 8:131236593-131236615 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1048093257 8:131263254-131263276 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1048429457 8:134356191-134356213 CTTTATCAGCAGTGTGAAGATGG - Intergenic
1048504889 8:135012288-135012310 CTTTATCAGTAGTGTGAAAATGG + Intergenic
1049074507 8:140383320-140383342 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1049907733 9:234881-234903 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1050016195 9:1236829-1236851 ATTTATCAGCAGTGAGAAAATGG - Intergenic
1050034746 9:1423729-1423751 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1050047227 9:1559573-1559595 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1050446366 9:5727530-5727552 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1050500926 9:6296501-6296523 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1050502418 9:6313117-6313139 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1050691891 9:8236649-8236671 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1050842672 9:10171831-10171853 CTTTATTAGCAGTGTGAAAATGG + Intronic
1051314891 9:15818352-15818374 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1051342019 9:16120714-16120736 TTTTTCTAGGAGTGAGCAGAAGG - Intergenic
1051390962 9:16562584-16562606 TTTTATTAGCAGTATGTAGAAGG - Intronic
1051404245 9:16717949-16717971 TTTTAGTAAAAGTGAGAAGTTGG - Intronic
1051522824 9:18009346-18009368 TTCTATTAGAAGTGAGTACAAGG - Intergenic
1051743490 9:20273726-20273748 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1052149977 9:25103143-25103165 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1052190857 9:25659679-25659701 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1052441097 9:28497643-28497665 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1052478414 9:28991022-28991044 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1052645517 9:31229496-31229518 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1052814126 9:33086571-33086593 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1052942924 9:34144706-34144728 TTTGATTAGAAGGGTGAAGAAGG + Intergenic
1052977640 9:34423147-34423169 TGTTATTATTATTTAGAAGAAGG - Intronic
1052992811 9:34531527-34531549 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1053041756 9:34879362-34879384 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1053490492 9:38497378-38497400 TATTATAAGGAGTGAGCAGATGG - Intergenic
1053533448 9:38904147-38904169 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1053827190 9:42037203-42037225 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1054205673 9:62128576-62128598 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1054603372 9:67150229-67150251 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1054632688 9:67459794-67459816 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1055556852 9:77483039-77483061 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1055568461 9:77592394-77592416 TTTTATTAGTTGTCAGAAATTGG + Intronic
1055815125 9:80195826-80195848 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1055951860 9:81736873-81736895 TTTTATTAATAATAAAAAGATGG - Intergenic
1056021518 9:82442924-82442946 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1056035728 9:82602992-82603014 CTTTATCAGTAGTGTGAAAATGG - Intergenic
1056416520 9:86382456-86382478 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1056861981 9:90193331-90193353 TTTGACTAGTTGAGAGAAGAAGG + Intergenic
1056909728 9:90687415-90687437 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1057400595 9:94719905-94719927 TTCTATTACTAGGGGGAAGAGGG + Intergenic
1057705200 9:97390793-97390815 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1058275392 9:103035643-103035665 TTTAAATAGTAGTGAGAAAATGG - Intergenic
1058305707 9:103438517-103438539 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1058337925 9:103855797-103855819 CTTTATTAGCAGTGTGAAAATGG + Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1058595057 9:106606127-106606149 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1058943688 9:109836536-109836558 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1059263000 9:112996975-112996997 TGCTATTTGTACTGAGAAGAAGG - Intergenic
1059952501 9:119481071-119481093 TGTTATTAGTAAGAAGAAGAAGG - Intergenic
1060036837 9:120262994-120263016 TTTTATTGATAGTGAGACTAAGG + Intergenic
1061648156 9:132023396-132023418 TTTTATGGGTAGTGTGAAAAAGG + Intronic
1062299338 9:135856142-135856164 CTTTATCAGCAGTGTGAAGATGG - Intronic
1185825889 X:3249419-3249441 TTTTATCAGCAGTGTGAAAACGG - Intergenic
1185951472 X:4440180-4440202 TTTTATTAGCAGTGTGAGAATGG - Intergenic
1186155548 X:6722101-6722123 TTTTTTTGGTAGTGCGATGAAGG - Intergenic
1186270168 X:7878308-7878330 TTTTATTAGCAGTGTGAGAATGG + Intergenic
1186293465 X:8123956-8123978 TTTGATGAGTATTGAGAAGAAGG - Intergenic
1186702630 X:12107556-12107578 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1186751769 X:12628820-12628842 CTTTATTAGGAGTGTGAAGACGG - Intronic
1186923356 X:14305853-14305875 TGTTATTAGTAGGGGGAAAAGGG + Intergenic
1187105276 X:16235684-16235706 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1187566656 X:20456820-20456842 CTTTATTAGTAGTGTGAGAATGG + Intergenic
1187769378 X:22677971-22677993 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1189045512 X:37586781-37586803 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1189382355 X:40511068-40511090 CTTTATTAGCAGTGTGAAAACGG + Intergenic
1189939363 X:46105003-46105025 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1190209674 X:48434586-48434608 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1190271627 X:48868690-48868712 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1190497602 X:51041589-51041611 CTTTATTAGCAGTGTGAAAACGG - Intergenic
1190531209 X:51378427-51378449 TTATCTTAGTAGTGCTAAGAGGG + Intergenic
1190590550 X:51996286-51996308 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1190603107 X:52112268-52112290 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1190621687 X:52292927-52292949 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1190807540 X:53853431-53853453 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1190942040 X:55051793-55051815 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1190962987 X:55270238-55270260 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1191170603 X:57443598-57443620 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1191187115 X:57624714-57624736 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1191232808 X:58109244-58109266 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1191589809 X:62870201-62870223 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1191683448 X:63865319-63865341 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1191923025 X:66278000-66278022 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1191938801 X:66454981-66455003 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1191969076 X:66794020-66794042 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192029080 X:67489500-67489522 TTTAACGAGTAGAGAGAAGAAGG + Intergenic
1192066277 X:67888944-67888966 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192097316 X:68225878-68225900 TTTGATGAGTTGAGAGAAGAAGG + Intronic
1192287578 X:69755046-69755068 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1192295816 X:69846692-69846714 ACTTGTTAGTATTGAGAAGAAGG + Intronic
1192532565 X:71902051-71902073 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192685848 X:73304614-73304636 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192761564 X:74100051-74100073 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192827489 X:74713104-74713126 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1192918933 X:75685372-75685394 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1192932707 X:75824955-75824977 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1192993459 X:76487529-76487551 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1193009933 X:76665257-76665279 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1193035983 X:76951502-76951524 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1193156198 X:78176604-78176626 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1193157563 X:78189999-78190021 TTTGATGAGTTGGGAGAAGAAGG + Intergenic
1193173325 X:78362171-78362193 TTTTTTTAGTTCTGTGAAGAAGG - Intergenic
1193229868 X:79031571-79031593 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1193252445 X:79308070-79308092 TTTTATCAGCAGTGTGAAAACGG + Intergenic
1193323836 X:80156287-80156309 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1193367457 X:80651720-80651742 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1193544274 X:82807778-82807800 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1193592610 X:83408250-83408272 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1193620947 X:83751642-83751664 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1193735184 X:85147981-85148003 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1194040728 X:88938816-88938838 TTTTATCAGCAGTGTGAAAATGG + Intergenic
1194300482 X:92180901-92180923 CTTTATTAGCAGTGTGAAAATGG + Intronic
1194826119 X:98565075-98565097 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1195103941 X:101585020-101585042 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1195242252 X:102963914-102963936 TTTAGTTATTAGTGAGAAAATGG + Intergenic
1195391306 X:104365625-104365647 TTTGATGAGTGGAGAGAAGAAGG - Intergenic
1195817567 X:108904795-108904817 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1195826881 X:109011527-109011549 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1195874148 X:109520755-109520777 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1195976195 X:110530213-110530235 TGTGATGAGTAGAGAGAAGATGG + Intergenic
1196255140 X:113509437-113509459 TTTTTTTAATAGTCACAAGATGG + Intergenic
1196313964 X:114201137-114201159 TTATATTAATACTGAGAAAAGGG - Intergenic
1196901652 X:120390057-120390079 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1196944772 X:120812659-120812681 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1197239576 X:124109383-124109405 TTTGATGAGTTGAGAGAAGAAGG - Intronic
1197566566 X:128095178-128095200 TTTTATCAGCAGTGTGAAAATGG - Intergenic
1197957094 X:131963220-131963242 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1197999958 X:132423427-132423449 TTTTTTTAGGGGTGAGGAGAAGG - Intronic
1198166349 X:134061637-134061659 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1198365994 X:135940753-135940775 TTTGACTAGTTGAGAGAAGAAGG - Intergenic
1198615782 X:138456984-138457006 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1199284418 X:146039776-146039798 CTTTATCAGTAGTGTGAAAATGG + Intergenic
1200296623 X:154926254-154926276 CTTTATTAGCAGTGTGAAAATGG + Intronic
1200833406 Y:7710111-7710133 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1200879222 Y:8194609-8194631 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201053625 Y:9966590-9966612 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1201067458 Y:10111936-10111958 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1201258715 Y:12136004-12136026 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201425896 Y:13850911-13850933 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
1201450215 Y:14103285-14103307 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201527639 Y:14953906-14953928 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201541931 Y:15114260-15114282 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201590778 Y:15612027-15612049 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201634548 Y:16108013-16108035 CTTTATTAGCAGTGTGAAAATGG - Intergenic
1201684399 Y:16684347-16684369 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1201698838 Y:16857685-16857707 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1201909421 Y:19119287-19119309 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1201988192 Y:19992848-19992870 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1202064543 Y:20924827-20924849 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1202170885 Y:22042065-22042087 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1202220478 Y:22544308-22544330 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1202322635 Y:23651355-23651377 TTTGATGAGTTGAGAGAAGAAGG + Intergenic
1202548138 Y:26018701-26018723 TTTGATGAGTTGAGAGAAGAAGG - Intergenic
1202591177 Y:26485085-26485107 TTTTGTTTGTGGTGAAAAGAAGG + Intergenic