ID: 1031552475

View in Genome Browser
Species Human (GRCh38)
Location 7:123132224-123132246
Sequence TTTTATTAGTAGTGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031552475_1031552480 20 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA No data
Right 1031552480 7:123132267-123132289 AAGCAGAAAGAGGAATCAAGAGG 0: 1
1: 1
2: 2
3: 69
4: 717
1031552475_1031552481 21 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA No data
Right 1031552481 7:123132268-123132290 AGCAGAAAGAGGAATCAAGAGGG No data
1031552475_1031552482 22 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA No data
Right 1031552482 7:123132269-123132291 GCAGAAAGAGGAATCAAGAGGGG No data
1031552475_1031552479 10 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA No data
Right 1031552479 7:123132257-123132279 TCTGGAGAAAAAGCAGAAAGAGG 0: 1
1: 0
2: 9
3: 80
4: 713
1031552475_1031552477 -8 Left 1031552475 7:123132224-123132246 CCATCTTCTCACTACTAATAAAA No data
Right 1031552477 7:123132239-123132261 TAATAAAACCATGGCAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031552475 Original CRISPR TTTTATTAGTAGTGAGAAGA TGG (reversed) Intronic
No off target data available for this crispr