ID: 1031560911

View in Genome Browser
Species Human (GRCh38)
Location 7:123236829-123236851
Sequence AACCCAAACCTCTTGTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031560911_1031560912 8 Left 1031560911 7:123236829-123236851 CCAGACTACAAGAGGTTTGGGTT No data
Right 1031560912 7:123236860-123236882 CTTCTTTATAGTTTTTAAATAGG No data
1031560911_1031560913 25 Left 1031560911 7:123236829-123236851 CCAGACTACAAGAGGTTTGGGTT No data
Right 1031560913 7:123236877-123236899 AATAGGACATTGTTTGTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031560911 Original CRISPR AACCCAAACCTCTTGTAGTC TGG (reversed) Intergenic
No off target data available for this crispr