ID: 1031564194

View in Genome Browser
Species Human (GRCh38)
Location 7:123274650-123274672
Sequence CTGAATGGGCACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031564194_1031564199 25 Left 1031564194 7:123274650-123274672 CCTTCCTCCTTGTGCCCATTCAG No data
Right 1031564199 7:123274698-123274720 TATGCTTACTTATGTATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031564194 Original CRISPR CTGAATGGGCACAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr