ID: 1031564993

View in Genome Browser
Species Human (GRCh38)
Location 7:123285188-123285210
Sequence CGCCCCCACATGGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031564993_1031564997 7 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031564997 7:123285218-123285240 GAGAAGCACCAGAATCAGTCAGG No data
1031564993_1031564999 14 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031564999 7:123285225-123285247 ACCAGAATCAGTCAGGAGGCAGG No data
1031564993_1031565002 24 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565002 7:123285235-123285257 GTCAGGAGGCAGGAGCATGGAGG No data
1031564993_1031565005 27 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565005 7:123285238-123285260 AGGAGGCAGGAGCATGGAGGGGG No data
1031564993_1031565004 26 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565004 7:123285237-123285259 CAGGAGGCAGGAGCATGGAGGGG No data
1031564993_1031564998 10 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031564998 7:123285221-123285243 AAGCACCAGAATCAGTCAGGAGG No data
1031564993_1031565006 28 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565006 7:123285239-123285261 GGAGGCAGGAGCATGGAGGGGGG No data
1031564993_1031565003 25 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565003 7:123285236-123285258 TCAGGAGGCAGGAGCATGGAGGG No data
1031564993_1031565001 21 Left 1031564993 7:123285188-123285210 CCCCATCACACCATGTGGGGGCG No data
Right 1031565001 7:123285232-123285254 TCAGTCAGGAGGCAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031564993 Original CRISPR CGCCCCCACATGGTGTGATG GGG (reversed) Intergenic
No off target data available for this crispr