ID: 1031567086

View in Genome Browser
Species Human (GRCh38)
Location 7:123313792-123313814
Sequence CCCCATTAAAATGGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031567086_1031567093 11 Left 1031567086 7:123313792-123313814 CCCAGGGGCCCATTTTAATGGGG No data
Right 1031567093 7:123313826-123313848 GTTTAATTAAACTAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031567086 Original CRISPR CCCCATTAAAATGGGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr