ID: 1031568554

View in Genome Browser
Species Human (GRCh38)
Location 7:123329990-123330012
Sequence GCAGCCTTCTTGACTGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031568551_1031568554 6 Left 1031568551 7:123329961-123329983 CCAAAAGCAAAGAAGGAGAAGGA No data
Right 1031568554 7:123329990-123330012 GCAGCCTTCTTGACTGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031568554 Original CRISPR GCAGCCTTCTTGACTGGTGT AGG Intergenic
No off target data available for this crispr