ID: 1031570697

View in Genome Browser
Species Human (GRCh38)
Location 7:123355839-123355861
Sequence AGGCTGTTCGTGAGCAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031570695_1031570697 12 Left 1031570695 7:123355804-123355826 CCTGAACGGCTGGGCTTCAGTGA No data
Right 1031570697 7:123355839-123355861 AGGCTGTTCGTGAGCAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031570697 Original CRISPR AGGCTGTTCGTGAGCAAAAA AGG Intergenic
No off target data available for this crispr