ID: 1031571585

View in Genome Browser
Species Human (GRCh38)
Location 7:123365987-123366009
Sequence GAGTGGAAGTTTCAACTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031571584_1031571585 -10 Left 1031571584 7:123365974-123365996 CCACTACTTTGATGAGTGGAAGT No data
Right 1031571585 7:123365987-123366009 GAGTGGAAGTTTCAACTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031571585 Original CRISPR GAGTGGAAGTTTCAACTGCT AGG Intergenic
No off target data available for this crispr