ID: 1031576374

View in Genome Browser
Species Human (GRCh38)
Location 7:123419902-123419924
Sequence GGATCCACAGAGTACCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031576369_1031576374 -2 Left 1031576369 7:123419881-123419903 CCTCTATGCAAGCCCAGTGGTGG No data
Right 1031576374 7:123419902-123419924 GGATCCACAGAGTACCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031576374 Original CRISPR GGATCCACAGAGTACCAGCT GGG Intergenic
No off target data available for this crispr