ID: 1031579818

View in Genome Browser
Species Human (GRCh38)
Location 7:123459152-123459174
Sequence TTTCAGTACCGTATCTATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031579818_1031579819 -5 Left 1031579818 7:123459152-123459174 CCTACATAGATACGGTACTGAAA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1031579819 7:123459170-123459192 TGAAATTAAATCACATCTAATGG No data
1031579818_1031579820 16 Left 1031579818 7:123459152-123459174 CCTACATAGATACGGTACTGAAA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1031579820 7:123459191-123459213 GGAGATTATCCTTATCTGAAAGG 0: 1
1: 0
2: 1
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031579818 Original CRISPR TTTCAGTACCGTATCTATGT AGG (reversed) Intronic
901178720 1:7324879-7324901 TTAAGGTACCATATCTATGTTGG - Intronic
901265208 1:7904927-7904949 TTTAAGTCCCCTTTCTATGTGGG - Intergenic
908113922 1:60923087-60923109 TTTCAGTATCGTATCCAGGGTGG - Intronic
908631126 1:66108565-66108587 TTTCAGTTCCTTATGTATTTTGG - Intronic
908681524 1:66667084-66667106 TTTTTGTACCCTAACTATGTGGG + Intronic
909354622 1:74694162-74694184 TTTCAGTACCGTAACAATATAGG - Intergenic
914399319 1:147302128-147302150 TTTCAGTTCCTTATATATTTTGG - Intergenic
915010664 1:152683178-152683200 TTCCTGTACCATATCTTTGTAGG - Intergenic
918452932 1:184677246-184677268 TTTCAGTTCCTTATATATTTTGG - Intergenic
919000182 1:191821644-191821666 TATCAGTACCCTTTCTATTTTGG - Intergenic
921498981 1:215876965-215876987 TTTCAGTAACTTTTCTATGTGGG - Intronic
923932580 1:238719507-238719529 TTTGAGTTCCTTATCTATTTTGG - Intergenic
1066021005 10:31301973-31301995 TTTGAGTACCTTATGTATTTTGG + Intergenic
1066129592 10:32379551-32379573 TTTCAGTACTGTATTTATTTTGG - Intergenic
1071593576 10:86900576-86900598 TTTCATTAATGTATCTAGGTTGG - Intronic
1076642528 10:131928470-131928492 TTTAAGTACTGTATCTTTTTTGG + Intronic
1081044746 11:38258892-38258914 TTTCAGTTCCTTATATATTTGGG + Intergenic
1082222511 11:49657034-49657056 TTTCAGTTACATATGTATGTAGG - Intergenic
1087336766 11:96853371-96853393 TTTCAGTACCTTTTCTTTGTGGG + Intergenic
1087371980 11:97295742-97295764 TTTTTGTACTGTATCTATTTTGG + Intergenic
1093039175 12:14359440-14359462 TTTAGGTAGCCTATCTATGTTGG + Intergenic
1097468919 12:59964089-59964111 TAGCAGTACCTTATGTATGTAGG + Intergenic
1097471695 12:60001028-60001050 TTTAAGTTCCGTATAAATGTTGG + Intergenic
1099867389 12:88300464-88300486 TTTTATTACCTTATCTGTGTGGG - Intergenic
1100445300 12:94654518-94654540 TTTCAGGACAGTATCTCTGGTGG + Intergenic
1101012878 12:100469495-100469517 TTTCAGTACGATATTTATATTGG + Intergenic
1104883617 12:132090112-132090134 TTTCAGTTCCTTATATATTTTGG + Intronic
1105734604 13:23255008-23255030 TTCTAGTACAGTATCTTTGTGGG - Intronic
1106819544 13:33448956-33448978 TTTCAGTTCCCTATATATTTTGG + Intergenic
1111093272 13:83475053-83475075 TTTCAGTTCCTTGTCTATTTTGG - Intergenic
1113206085 13:107917731-107917753 TTTCAGTTCCTTATAGATGTTGG + Intergenic
1113267772 13:108638467-108638489 TTTCAGTACAGTAACAGTGTGGG - Intronic
1116177541 14:41492151-41492173 TTTCAGTTCCTTGTCTATGCTGG - Intergenic
1116400214 14:44497325-44497347 TTTCAGTACTGTTTCTAGGTAGG - Intergenic
1117139863 14:52778199-52778221 TTTCAGTCCAGTATTTATGGAGG + Exonic
1120021053 14:79530499-79530521 TTTCTGTACCATCTCTATATGGG + Intronic
1123185613 14:106513801-106513823 TTCTAGCACCTTATCTATGTAGG - Intergenic
1127204563 15:56700690-56700712 TTTCATTACTGTACCTATTTAGG + Intronic
1129520064 15:76180206-76180228 CCTGAGTACCGTATCAATGTGGG - Intronic
1131901760 15:97095273-97095295 TTTGAGTCCCTCATCTATGTGGG - Intergenic
1150548221 17:66185134-66185156 TTTCTGTACACTATCTATGTAGG + Intronic
1151547746 17:74803537-74803559 TTTCAGGACCGTTTCTTTGCAGG + Intronic
1154396063 18:13990466-13990488 TTTCAGTTCCTTATATATTTTGG - Intergenic
1155863679 18:30936845-30936867 TTTGAGTTCCTTATATATGTTGG + Intergenic
1155933855 18:31734640-31734662 TTTCAGTTCCTTATATATTTTGG - Intergenic
1159071960 18:63634278-63634300 TTTCAGTTCCTTATATATTTTGG - Intergenic
1159073427 18:63652206-63652228 TTTCAGTTCCTTATATATTTTGG - Intronic
1159166812 18:64713200-64713222 TTTCAGTAACATTTATATGTGGG - Intergenic
1160125521 18:76168289-76168311 TTTCTTTACCTTATCTATTTGGG + Intergenic
1163058128 19:14737659-14737681 TTGCAGTAAAGTATCTATCTGGG + Intronic
1164067340 19:21729335-21729357 TTTCAGTACATTTTGTATGTAGG - Intronic
1164081181 19:21862740-21862762 TTTCAAAACCTTTTCTATGTGGG + Intergenic
1164252589 19:23494467-23494489 TTTCAGCACCCTTTATATGTAGG - Intergenic
1164319147 19:24124506-24124528 TTTCAGCACCTTTTATATGTAGG + Intronic
926539817 2:14161627-14161649 TTTCAGAATTATATCTATGTTGG + Intergenic
926557197 2:14372586-14372608 TTTCAGTTCCTTATAGATGTTGG - Intergenic
930282470 2:49386925-49386947 TTTAAGTACCATATATATTTTGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
938128079 2:128688838-128688860 TGCCAGGACCTTATCTATGTTGG - Intergenic
940571004 2:155433089-155433111 TTTGAGTACAGTATTTTTGTGGG + Intergenic
943852509 2:192742976-192742998 TTTCAGTAATGTATTAATGTAGG - Intergenic
948045751 2:234942785-234942807 TTTGAGTACCTTATATATTTTGG + Intergenic
1174804980 20:53597287-53597309 TTTACGTCCCGTATCTATGTTGG - Intronic
950599644 3:14021533-14021555 TTTCAGTTCCTTATATATGCTGG + Intronic
953288551 3:41637908-41637930 TTTGAGTTCCTTATATATGTTGG + Intronic
955536023 3:59924463-59924485 TGTCAGTATCTTATCTATATGGG + Intronic
957718354 3:83963156-83963178 TTTCAGTTCCTTATATATTTCGG + Intergenic
959283027 3:104370984-104371006 TTTGAGTAGCATATCTATGAAGG - Intergenic
970666704 4:18344723-18344745 TTCCAGTAATGTATCTATATGGG + Intergenic
972048132 4:34694641-34694663 TTTCTGTACCTTTTCAATGTGGG + Intergenic
972867480 4:43251711-43251733 TTTCACTACCTTATCTGTCTCGG - Intergenic
972923774 4:43976929-43976951 TATCACTACTGTATTTATGTGGG - Intergenic
975067815 4:70089878-70089900 TTTAAGTATTGTAGCTATGTAGG - Intergenic
975538571 4:75478300-75478322 CTTCAGTACCTTATGTATTTTGG - Intergenic
980776132 4:137438528-137438550 TTTCAGTACCTTTTCCATGAGGG - Intergenic
982849051 4:160288920-160288942 TTCCAGTACTGTATCTCTGTTGG - Intergenic
982949805 4:161678472-161678494 TTTCAGTAATGTATTTGTGTAGG - Intronic
984894305 4:184523320-184523342 TTTAAGTACCTTGTATATGTTGG + Intergenic
986771892 5:10981667-10981689 TTTCAGTTCTTTATGTATGTTGG + Intronic
991140020 5:63229801-63229823 TTTCAGTATTCTATCTATTTGGG + Intergenic
996607338 5:125339106-125339128 TTTCAGTTCCTTATATATTTTGG + Intergenic
997146226 5:131436717-131436739 TTTCTGTAAAGTAACTATGTAGG + Intronic
1000550828 5:162661544-162661566 TTTGAGTTCCTTATCTATTTTGG + Intergenic
1004879620 6:19994951-19994973 TTTTATTACCTGATCTATGTTGG + Intergenic
1005100228 6:22164664-22164686 TTTCAGTACCGTGTATATTCTGG + Intergenic
1006895510 6:37466685-37466707 TTTTAGTACTGTAGCTTTGTAGG + Intronic
1008352372 6:50506985-50507007 TTTGGGTCCCATATCTATGTTGG - Intergenic
1010780966 6:79946408-79946430 TTTAAGAACTGTATATATGTAGG + Intronic
1013810212 6:114036372-114036394 TTTAAGTTCCGTATCGATGGGGG - Intergenic
1017372538 6:153729511-153729533 TTTGAGTTCCTTATATATGTTGG - Intergenic
1017742249 6:157417153-157417175 TTCCAGAATTGTATCTATGTGGG + Intronic
1020406579 7:7842035-7842057 TTTCTGTACAGTGTCTCTGTCGG + Intronic
1024035066 7:45500948-45500970 TTTCATTACAGTATCTACTTTGG + Intergenic
1028064893 7:86371091-86371113 TTTCAGTTCCTTATATATTTTGG - Intergenic
1028288716 7:89038535-89038557 TTTGAGTTCCGTATGTATTTTGG + Intronic
1030344052 7:108413398-108413420 TTTCAGTTCCTTATATATTTTGG + Intronic
1031579818 7:123459152-123459174 TTTCAGTACCGTATCTATGTAGG - Intronic
1038316395 8:26488215-26488237 TTTGAGTTCCTTATCTATTTTGG + Intronic
1044179978 8:89179435-89179457 TTTGAGTCCCTTATCTATTTTGG - Intergenic
1045827218 8:106412535-106412557 TTTCAGAACCAAATTTATGTTGG + Intronic
1049036956 8:140084311-140084333 TTTTATTACCCTATCTATTTAGG - Intronic
1050973119 9:11902509-11902531 ATTCATTACCTTTTCTATGTTGG + Intergenic
1051117054 9:13707831-13707853 TTTCAGTTCCCTTTCCATGTGGG - Intergenic
1052482352 9:29047176-29047198 TTTAAGTACCTTATAGATGTTGG - Intergenic
1057858551 9:98621812-98621834 TTTCAGCACCGGATATCTGTAGG - Intronic
1059529735 9:115024851-115024873 TTTCAGTACCATTGCTTTGTGGG + Intronic
1062679109 9:137767368-137767390 TTGATGTACCGTATCTATGAAGG + Intronic
1186358936 X:8818608-8818630 TTTGAGTTCCCTATTTATGTGGG + Intergenic
1186593687 X:10958188-10958210 TTTCAGTTCCGTATGGATGCTGG - Intergenic
1188621205 X:32226234-32226256 TTTCAGTACAGTATACATGGTGG - Intronic
1189162945 X:38829762-38829784 TTTGAGTTCCTTATATATGTGGG - Intergenic
1196408005 X:115385984-115386006 TTTCCTGACAGTATCTATGTGGG - Intergenic
1197582178 X:128297104-128297126 TTTCAGTTCCTTATATATTTTGG - Intergenic
1198134004 X:133728588-133728610 TCTCAGCACTGTATCTATGCAGG + Intronic
1200014072 X:153145997-153146019 TTACAGTACAATATCCATGTTGG - Intergenic
1200025528 X:153253956-153253978 TTACAGTACAATATCCATGTTGG + Intergenic