ID: 1031580731

View in Genome Browser
Species Human (GRCh38)
Location 7:123471634-123471656
Sequence TGTTAGGCTAAAAACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031580731_1031580738 5 Left 1031580731 7:123471634-123471656 CCCCCCAAGTTTTTAGCCTAACA 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1031580738 7:123471662-123471684 AGCATAATGTGGTTAGATCTTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1031580731_1031580737 -6 Left 1031580731 7:123471634-123471656 CCCCCCAAGTTTTTAGCCTAACA 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1031580737 7:123471651-123471673 CTAACAAATATAGCATAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031580731 Original CRISPR TGTTAGGCTAAAAACTTGGG GGG (reversed) Intronic
908950986 1:69562341-69562363 TGCTGGGCTTAATACTTGGGTGG + Intergenic
909401445 1:75236178-75236200 TGTTAACCAAGAAACTTGGGTGG + Intronic
909929147 1:81475058-81475080 TAGAAGGCTAAAGACTTGGGGGG - Intronic
917186623 1:172363815-172363837 TGTTAGGGAAAATACTGGGGAGG - Intronic
919968523 1:202554296-202554318 TTTTAGGCTAAAAACCTGAAAGG + Intronic
920222662 1:204415610-204415632 TGCTATGCCAACAACTTGGGAGG - Intergenic
920512727 1:206562798-206562820 TGGCAGGCTAACTACTTGGGAGG + Intronic
920632545 1:207666750-207666772 TACTAGGCTTAATACTTGGGTGG + Intronic
920657391 1:207887063-207887085 TGTTTGTCCTAAAACTTGGGAGG + Exonic
921124007 1:212160928-212160950 TGTTAGGGTAAAAAGTTGGTAGG - Intergenic
921777682 1:219121315-219121337 TGCAAGGCTATATACTTGGGTGG - Intergenic
1064625531 10:17257839-17257861 TGGTAGGGCAAAAACTTGAGAGG + Intergenic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1065780815 10:29164945-29164967 TGTTAGGCAATAAAATTTGGGGG + Intergenic
1066276438 10:33873096-33873118 CCTTAGACTAAAATCTTGGGTGG + Intergenic
1069987465 10:72294174-72294196 TGACAGGCTAAAAACTGGCGGGG - Intergenic
1073742657 10:106426256-106426278 TTTGAGGCAAAAAACTTGGGAGG + Intergenic
1077986996 11:7362590-7362612 TGTTAGGCTGAAAAATTGGTAGG + Intronic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1083295356 11:61712416-61712438 TGTTAGCCTAAGACCCTGGGCGG + Intronic
1084352495 11:68612516-68612538 TGTTAGGCTCAAAACTGGGAGGG - Intronic
1090502748 11:127277616-127277638 AGTTATGGTAAAAACTTTGGGGG + Intergenic
1091289092 11:134427305-134427327 GGGTAGGCTAAAATCTTGGCAGG + Intergenic
1092485463 12:8898838-8898860 TCTTAGGCCAAAAACTTTGGAGG + Intergenic
1094155914 12:27336633-27336655 TTTTAAGTTAAAAAATTGGGTGG - Intronic
1098021365 12:66159579-66159601 TGTTAAGCTACAAAATTTGGGGG + Intronic
1098076372 12:66736299-66736321 TGTAATCCTAACAACTTGGGAGG - Intronic
1099734167 12:86546439-86546461 TGGTAGGTGAAAAACTTGGTAGG + Intronic
1100989271 12:100234805-100234827 TGTTAGGCTAAACAGTTTGGAGG - Intronic
1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG + Intergenic
1101229380 12:102724385-102724407 TGATTGGCTCAGAACTTGGGTGG + Intergenic
1103299102 12:119914045-119914067 TGTTAGGTAAAAACTTTGGGCGG + Intergenic
1106875278 13:34065256-34065278 CGTTAGGATAAAAACTGGGATGG + Intergenic
1117451377 14:55853320-55853342 TGTTATACTAAAACCTTGCGGGG - Intergenic
1123416349 15:20098447-20098469 TGTTATCCTAACAATTTGGGAGG - Intergenic
1123501737 15:20891515-20891537 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1123525688 15:21105552-21105574 TGTTATCCTAACAATTTGGGAGG - Intergenic
1123558989 15:21465214-21465236 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1123595219 15:21902495-21902517 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1125366042 15:38917252-38917274 TAAAATGCTAAAAACTTGGGAGG - Intergenic
1125755458 15:42061208-42061230 TCTTAGGATCAGAACTTGGGAGG - Intergenic
1126295111 15:47130638-47130660 TGTTGTGCTAAATACTTGAGGGG - Intergenic
1126896677 15:53264961-53264983 TCATAGGCTCACAACTTGGGGGG - Intergenic
1128329839 15:66748250-66748272 GGTTAGGCAAAAAAATAGGGAGG + Intronic
1130804189 15:87301314-87301336 GGTTAGGATATAAATTTGGGGGG + Intergenic
1131958145 15:97759787-97759809 TGTTATGCCAAAATTTTGGGCGG - Intergenic
1134407794 16:13977288-13977310 TGTTAGGCAAAAAACATATGTGG - Intergenic
1137693534 16:50446214-50446236 GGTAAGGCTAAACCCTTGGGAGG + Intergenic
1138962308 16:62041747-62041769 TGTTTTGCTAAACACTTAGGTGG - Intergenic
1147440947 17:40446970-40446992 TGTAAGGCTAAAAAGATGGGTGG - Intronic
1150873117 17:68937245-68937267 AGTTAGACTAAAATGTTGGGTGG + Intronic
1155870651 18:31023246-31023268 TGTGAGGCTAAAAACATTGTAGG + Intronic
1158880727 18:61777231-61777253 TATTAGGCTTAATACCTGGGTGG + Intergenic
1161567421 19:5011508-5011530 TGTGGGGCTGAAGACTTGGGTGG + Intronic
1162181170 19:8869911-8869933 TACTAGGCTTAATACTTGGGTGG + Intronic
1163879396 19:19903935-19903957 TGTAATCCTAGAAACTTGGGAGG + Intronic
1164229009 19:23271542-23271564 TAGTAGGCTTAATACTTGGGTGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
927902473 2:26830609-26830631 TGTTATGCTAGCTACTTGGGAGG + Intergenic
927976845 2:27345160-27345182 TGGGAGGCTGAAGACTTGGGAGG + Intronic
929640380 2:43572313-43572335 TGCTAGGCTAAAGACTTAGTTGG - Intronic
930461691 2:51687529-51687551 TGTAATGCCAACAACTTGGGAGG + Intergenic
930844483 2:55887433-55887455 TAATTGGCTAAAAACTGGGGAGG - Intronic
934169478 2:89327840-89327862 TGTTAGGTTTAAAAGTTGCGTGG - Intergenic
934197816 2:89854745-89854767 TGTTAGGTTTAAAAGTTGCGTGG + Intergenic
935090234 2:99889034-99889056 TTTTAGGCTTAAAACCTAGGAGG + Intronic
935828753 2:106977290-106977312 TGTTAGTCTTAGATCTTGGGAGG + Intergenic
936442858 2:112570565-112570587 TCCTAGGCTACAAACCTGGGTGG + Intronic
939495267 2:142920927-142920949 TTTTAAGCTAAATATTTGGGAGG - Intronic
943677658 2:190731934-190731956 CCTTAGGCCAAAAGCTTGGGAGG + Intergenic
943993125 2:194722898-194722920 TGTTAGGCTAAAAACATCAGTGG - Intergenic
945832025 2:214798993-214799015 TGTAATGCCAACAACTTGGGAGG + Intronic
946787987 2:223268186-223268208 TCTCAGGCTAAAAACTTTGGAGG + Intergenic
947211258 2:227710648-227710670 AGATAGTCTAAAAACTGGGGGGG - Intronic
947233131 2:227909595-227909617 TGAAAACCTAAAAACTTGGGGGG + Intronic
1176723648 21:10412963-10412985 TGTTGGGAAAAAAAATTGGGGGG - Intergenic
1182936769 22:34230229-34230251 TTTTAGGCTTAAAACTTTGCAGG + Intergenic
1182955956 22:34426650-34426672 TGTTAGGCTTAGTACCTGGGTGG + Intergenic
1184996835 22:48213471-48213493 TGTTAGATTAAAAACCTGCGAGG + Intergenic
951460196 3:22943190-22943212 TGAGAGGCTAAAATCTTGGTGGG - Intergenic
951626086 3:24664579-24664601 TGTAAGGGTAAAATCTTGGCCGG - Intergenic
955131930 3:56178634-56178656 TGTCAGTCTTAAAACATGGGAGG + Intronic
957855428 3:85870347-85870369 TGCTAGGCTCAAGACTTTGGTGG - Intronic
963760175 3:149280207-149280229 TGTGAGGCTAAATACCTTGGAGG + Intergenic
964348417 3:155778541-155778563 TTTTAGGAGAAAAAGTTGGGAGG + Intronic
966248212 3:177832166-177832188 TGTAAGGGTAAGAAGTTGGGAGG + Intergenic
967953251 3:194857165-194857187 TGCTAGGCTAATCACTTGAGGGG - Intergenic
973167425 4:47094658-47094680 TGCTAGGCTTAATACTTGGGTGG + Intronic
977572744 4:98646459-98646481 TGTTAGGCCTAACACCTGGGTGG - Intronic
977899813 4:102407046-102407068 GGGTAGGCCAAAAAATTGGGAGG - Intronic
979191987 4:117872869-117872891 TGTGAGCCTAAACACTGGGGTGG - Intergenic
979695151 4:123604584-123604606 TGAGGGGCTAAAGACTTGGGTGG + Intergenic
983557903 4:169074814-169074836 TGTTATGCTAGAACTTTGGGAGG + Intergenic
984226468 4:177041386-177041408 TGCTAGACTAAAAATCTGGGAGG - Intergenic
986120267 5:4828795-4828817 TGTTAGACTGGAAACATGGGAGG + Intergenic
987198391 5:15550174-15550196 TGTAAGCCTAGAAACTTGGCAGG + Intronic
991988505 5:72314644-72314666 TGTAATGCTAACTACTTGGGAGG - Intronic
1000083110 5:157865815-157865837 TGTGTGGGTAAAGACTTGGGTGG + Intergenic
1005922090 6:30411254-30411276 TGCTAGGCTTAATACCTGGGTGG + Intergenic
1006935983 6:37718531-37718553 TGTCAGGCTAAAATCTTAGCTGG + Intergenic
1011865588 6:91822214-91822236 TGTTTGAGTAAAAACTTTGGTGG - Intergenic
1012736219 6:102948408-102948430 TTCTAGGCTATAAACTTGTGCGG + Intergenic
1016368973 6:143351681-143351703 TGTGAGGCTTAAAACCTAGGTGG - Intergenic
1016895063 6:149043365-149043387 TGTTATGCTAACACTTTGGGAGG - Intronic
1018616457 6:165691387-165691409 TCTTAGGTTACAAACTTGGACGG - Intronic
1020843668 7:13255308-13255330 TGTGATGCTAAACACTTGTGCGG + Intergenic
1020970538 7:14932110-14932132 AGTTAGGCTTATAGCTTGGGAGG + Intronic
1024803179 7:53104629-53104651 TGTAATCCTAAATACTTGGGAGG + Intergenic
1024993050 7:55251284-55251306 TGTTTGGGTAAAGATTTGGGGGG + Intronic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1030618511 7:111763945-111763967 TGTAATCCCAAAAACTTGGGAGG - Intronic
1031580731 7:123471634-123471656 TGTTAGGCTAAAAACTTGGGGGG - Intronic
1031643311 7:124191763-124191785 TGTTAGGCTAACTAGTTTGGGGG + Intergenic
1031745205 7:125487571-125487593 TGATAGGCTTAATACCTGGGTGG + Intergenic
1032913418 7:136459975-136459997 TCTTTGGCTTAAAACTTGGCTGG + Intergenic
1036809042 8:11854584-11854606 TGGGAGGCTAAGAACCTGGGAGG - Intronic
1037195720 8:16186869-16186891 TGTAATGCCAAAAATTTGGGAGG - Intronic
1041507679 8:58618921-58618943 TGTTAGGCTAAAGAATTTGGGGG - Intronic
1041678147 8:60557392-60557414 TGTTATGCCAACTACTTGGGAGG + Intronic
1042054316 8:64747917-64747939 GGTAAGGCTAAAAACTTGCAGGG + Intronic
1042588834 8:70374544-70374566 TGTTATCCCAACAACTTGGGAGG + Intronic
1043738256 8:83774854-83774876 TTAAAGGCTAAATACTTGGGGGG - Intergenic
1045741222 8:105361916-105361938 TCTTAGGCTAAAAACCTGTACGG - Intronic
1047946941 8:129889729-129889751 TCTTATGATAAAAACTTGAGTGG + Intronic
1050709924 9:8449926-8449948 TGTAAAACTGAAAACTTGGGAGG - Intronic
1057738105 9:97686204-97686226 TGTTAGCTTAAAATATTGGGAGG - Intronic
1058500587 9:105611448-105611470 TACTAGGCTTAATACTTGGGTGG - Intronic
1059082076 9:111260809-111260831 TGATAGGTTGAAACCTTGGGAGG - Intergenic
1185645292 X:1611228-1611250 TGTTATCCTAGCAACTTGGGAGG - Intergenic
1187004235 X:15216175-15216197 TGTTAGGCCACAAAATTTGGAGG - Intergenic
1187035487 X:15534458-15534480 TGATAGGCAAAAGACTTGAGAGG - Intronic
1187266650 X:17739725-17739747 TGTTACGCTAACTACTCGGGAGG + Intronic
1188897743 X:35689856-35689878 TATTTGGCAAAAAACATGGGTGG - Intergenic
1189636759 X:43018923-43018945 TGGTAAGATAAATACTTGGGAGG + Intergenic
1192538972 X:71952324-71952346 TGTAATGCTAAGAACTTGGAGGG - Intergenic
1195500083 X:105586763-105586785 TGCTTGGCCAAAAACTTGAGAGG + Intronic
1199305275 X:146260166-146260188 TGTTAGACTCAAAATTTGTGAGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1202259423 Y:22954663-22954685 TCATAGTCTATAAACTTGGGTGG + Intergenic
1202304331 Y:23452270-23452292 TTTTAGGCTAAAAACCTGAAAGG + Intergenic
1202412409 Y:24588407-24588429 TCATAGTCTATAAACTTGGGTGG + Intergenic
1202458371 Y:25081663-25081685 TCATAGTCTATAAACTTGGGTGG - Intergenic
1202566479 Y:26218321-26218343 TTTTAGGCTAAAAACCTGAAAGG - Intergenic