ID: 1031583089

View in Genome Browser
Species Human (GRCh38)
Location 7:123501172-123501194
Sequence CTTCTTCTCACATGGAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031583082_1031583089 30 Left 1031583082 7:123501119-123501141 CCGGGGAAATCCTTGAAGGTGGC 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG 0: 1
1: 0
2: 0
3: 20
4: 188
1031583084_1031583089 20 Left 1031583084 7:123501129-123501151 CCTTGAAGGTGGCATTCATGGAA 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG 0: 1
1: 0
2: 0
3: 20
4: 188
1031583085_1031583089 -10 Left 1031583085 7:123501159-123501181 CCTTGACTTTTCCCTTCTTCTCA 0: 1
1: 1
2: 6
3: 96
4: 819
Right 1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG 0: 1
1: 0
2: 0
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031583089 Original CRISPR CTTCTTCTCACATGGAATGC AGG Intronic
900812868 1:4821257-4821279 GTTCTTCTCACATTGAAGTCAGG + Intergenic
900867477 1:5278560-5278582 CTTCTTCTCATATGTTAAGCAGG - Intergenic
903278363 1:22236064-22236086 CTTCTCCCCACAAGGAAGGCTGG + Intergenic
904912964 1:33949262-33949284 CATCTTCTCCCAGGGAATCCAGG - Intronic
905644737 1:39617279-39617301 CCCCTCCTCACAGGGAATGCAGG + Intergenic
906935822 1:50213260-50213282 ATTCTTCCCATTTGGAATGCTGG + Intergenic
907331940 1:53677304-53677326 CATCTTCTCACCTGGAAGGTGGG - Intronic
907989942 1:59570567-59570589 CTTATTTTCTCATGGAAAGCAGG + Intronic
909356056 1:74711468-74711490 CTTCCTCACAGATTGAATGCGGG + Intronic
910045811 1:82913953-82913975 TTGATTCTTACATGGAATGCAGG - Intergenic
916445475 1:164868063-164868085 CTTCCTCCCACATGAAATGCTGG - Intronic
916562584 1:165946006-165946028 CTACTTGTTACATGGAATACTGG - Intergenic
916974146 1:170056705-170056727 CTCCTTTTCATATGGAATTCTGG - Intronic
918788271 1:188792842-188792864 TTTCTTCCCTCATAGAATGCGGG - Intergenic
921456672 1:215380111-215380133 CTTCTCCTCAAATGGAAGGAAGG - Intergenic
921809785 1:219499506-219499528 ATTCTTCTCATATCAAATGCAGG - Intergenic
1063080691 10:2764629-2764651 CTTCTTCCCACCTGGTAGGCAGG - Intergenic
1063426232 10:5952199-5952221 CTTCTCCTCACATGGAATTGTGG + Intronic
1063684869 10:8227468-8227490 CGTCTTCTCCCCTGGTATGCTGG - Intergenic
1065220971 10:23495630-23495652 TTTCATAACACATGGAATGCTGG + Intergenic
1068803601 10:61170060-61170082 CTTCTTCTGAAATGCAAGGCAGG + Intergenic
1069441490 10:68432830-68432852 CTTCCTCTAACCTGGAGTGCAGG + Intronic
1069789982 10:71013228-71013250 CTTCTGCTCCCATGTGATGCTGG - Intergenic
1070442715 10:76462680-76462702 CCTCTCCTCACATGTACTGCTGG - Intronic
1071321350 10:84462378-84462400 CTTCTTCCCAACTGCAATGCAGG - Intronic
1073418546 10:103405042-103405064 ACTTTTCTCACCTGGAATGCTGG + Exonic
1074431310 10:113397276-113397298 TTCCTTCTCACATCAAATGCCGG + Intergenic
1075588141 10:123672073-123672095 CCTGTTCTCACCTGGAAAGCAGG + Intronic
1076386297 10:130058364-130058386 CTTCTTCTCTCAAGGAGTTCTGG + Intergenic
1076805270 10:132853442-132853464 ATTTTGCTCACAAGGAATGCTGG + Intronic
1077264307 11:1641559-1641581 CTTGTTTTCAGCTGGAATGCAGG + Intergenic
1077592122 11:3500393-3500415 CTTCTTATCATAGGGAATGACGG + Intergenic
1078861882 11:15256119-15256141 TTTCTACTCACAGGGAAGGCAGG + Intergenic
1080776702 11:35393426-35393448 CTTCTCCCCACAGTGAATGCAGG + Intronic
1081028878 11:38052171-38052193 CTTCTTTTCAAACAGAATGCTGG + Intergenic
1083366914 11:62146927-62146949 CTTCCACACACATGGAAGGCAGG - Intronic
1083512837 11:63227552-63227574 CCTCTCCTCAAATGGAATGAAGG + Intronic
1083514731 11:63246365-63246387 CTCCTTCTCAGGTGGAAGGCAGG + Intronic
1083574372 11:63779081-63779103 TTTCTTCTTCCTTGGAATGCTGG - Intergenic
1083882871 11:65557162-65557184 CTCCTCCTCCCAGGGAATGCAGG + Intronic
1084824862 11:71722359-71722381 CTTCTTATCACAGGGAATGACGG - Intergenic
1085003211 11:73060461-73060483 CTCCTTCTCACAGGCAATGAAGG + Intronic
1085792739 11:79509954-79509976 CTTGTTCTCACATGGAAAAGGGG - Intergenic
1089279831 11:117366071-117366093 CTTTTTGTCACATGGAGTGTTGG + Intronic
1091294158 11:134461022-134461044 CTGCCTCACACATGGCATGCTGG + Intergenic
1091662248 12:2393145-2393167 CTTCATCTCCCATGGAAACCTGG + Intronic
1091663012 12:2398644-2398666 CCTGTTCTGACCTGGAATGCTGG - Intronic
1092418240 12:8308525-8308547 CTTCTTATCACAGGGAATGACGG + Intergenic
1097311156 12:58120946-58120968 CTTCGTTTCCCTTGGAATGCAGG + Intergenic
1097805576 12:63961342-63961364 CATCTCCTCACATGGAATTCTGG + Intronic
1098278630 12:68839752-68839774 CTTCTTTGCACATGTAAAGCAGG - Exonic
1100293904 12:93242925-93242947 CTTCTCCCCAAAGGGAATGCTGG + Intergenic
1101214832 12:102570275-102570297 TTTATTCTCAAATCGAATGCAGG + Intergenic
1102830923 12:115998527-115998549 CTTCATCTAACAGGGAAGGCAGG + Intronic
1103694535 12:122804115-122804137 CTGTTTGTCAAATGGAATGCTGG - Intronic
1104461594 12:128960804-128960826 CTTCTTAAAAAATGGAATGCTGG - Intronic
1107438937 13:40406814-40406836 CTTGTTCTCAACTTGAATGCTGG - Intergenic
1107538918 13:41366688-41366710 CTTCTGCTAAAATGGAATGTAGG + Intronic
1109304143 13:60620100-60620122 CTATTTTTCACATGGAAGGCAGG - Intergenic
1109630608 13:65040511-65040533 CTTTTCGTCACATGGAATGGTGG + Intergenic
1109956167 13:69569288-69569310 CTTCTTCTTTCCTGGAATTCTGG + Intergenic
1117025360 14:51614288-51614310 ATTCTAGTCACATGGAATACAGG + Intronic
1117877228 14:60265730-60265752 CTTCTTGCCAGATGGAAGGCAGG + Intronic
1120823312 14:88932819-88932841 CTTCTTAACACATAGATTGCTGG + Intergenic
1121373060 14:93378228-93378250 CTTCAGCTCACATGGAAAGGTGG + Intronic
1121732970 14:96198946-96198968 CTTCCTCTCACAGGGAGTGGGGG - Intergenic
1121906554 14:97751565-97751587 CTTCCTCTCACAGGGAATGAGGG + Exonic
1123580576 15:21711787-21711809 CTGTTTCTCACATGGAATAATGG - Intergenic
1123617224 15:22154410-22154432 CTGTTTCTCACATGGAATAATGG - Intergenic
1124588194 15:31030166-31030188 CTTCCTCTCATATGGAATGTAGG - Intronic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1124801959 15:32841523-32841545 CTTCTTCTGAGATGGAGTGATGG - Intronic
1125551655 15:40549592-40549614 CATCTTCCCACATAGAATGATGG - Intronic
1126378006 15:48015765-48015787 CTTCATCTCACTTAAAATGCTGG + Intergenic
1126692870 15:51301404-51301426 CTTCATCTCATTTGGGATGCCGG + Intronic
1127046699 15:55033468-55033490 CTTAGTCTCACATGGAGTCCAGG - Intergenic
1130050498 15:80480058-80480080 TTTCCTCTCACCAGGAATGCTGG + Intronic
1131318390 15:91362494-91362516 CTTCTTGTCCCAAGGAATTCAGG + Intergenic
1202989446 15_KI270727v1_random:446032-446054 CTGTTTCTCACATGGAATAATGG - Intergenic
1132925454 16:2427011-2427033 CTTCTTGCAACATGGATTGCTGG - Intergenic
1133398940 16:5470655-5470677 CTTTTTCTACCATGGAGTGCAGG + Intergenic
1133930999 16:10232020-10232042 CTTCATCACTCAAGGAATGCAGG - Intergenic
1134375743 16:13671382-13671404 TTTATTCTCACATGCATTGCTGG + Intergenic
1135860001 16:26047548-26047570 CATCTTCTCACCTGGAAAGCAGG - Intronic
1135879494 16:26240408-26240430 CTTCTTCTCAAGTGGAAGGAAGG - Intergenic
1136107209 16:28038479-28038501 CTCCTTCTCACCTGGAAAGGAGG - Intronic
1146480351 17:33200200-33200222 CTTCTTCTCTCTTGGACTGAAGG + Intronic
1146568958 17:33936806-33936828 CTTCAGGTCACATGGAATGATGG - Intronic
1148368591 17:47075874-47075896 GTTCTTCTAACATGGAAATCTGG + Intergenic
1149003353 17:51779257-51779279 CATCTTCCCAGATGGAATTCTGG + Intronic
1149910728 17:60564583-60564605 CATCTCATCCCATGGAATGCAGG - Exonic
1150592467 17:66575773-66575795 TATCATCTAACATGGAATGCTGG - Intronic
1151417152 17:73973930-73973952 CTTCATCTCTCATGGAGTTCCGG + Intergenic
1156890076 18:42180632-42180654 CTTCACCTCACATCAAATGCAGG + Intergenic
1159596124 18:70384315-70384337 ATTCTCCTCACATGCAAAGCAGG - Intergenic
1160065737 18:75572786-75572808 CTTCTACTCACAGGGAAGCCAGG - Intergenic
1166711796 19:44942342-44942364 CTTCTTCTCACCCCCAATGCAGG - Exonic
1167682872 19:50935982-50936004 CCTCTTCTCACCTGGAATATGGG - Intergenic
1167752390 19:51388783-51388805 TTTCTTCTCACTTGGGATTCAGG + Exonic
1168530357 19:57123015-57123037 CTGCTTCCCACATGGTTTGCTGG + Intronic
927362652 2:22254068-22254090 GTTCTTCTCAGAGGGAATCCCGG + Intergenic
929279561 2:40063069-40063091 CTTCATCTCAAAGGGAATTCTGG - Intergenic
931086231 2:58833623-58833645 CTTCTTTTGACATGAAATTCAGG + Intergenic
931174780 2:59842863-59842885 CTTCTTTTCACTTGGAAGGAAGG - Intergenic
932570508 2:72935997-72936019 GTTCTTCCCACCTGGAATGTCGG + Intronic
933889300 2:86751985-86752007 CTTCTTTCGACAAGGAATGCTGG + Exonic
937355856 2:121197689-121197711 ATTCTTCTCCCATGGACTGAGGG + Intergenic
937385068 2:121422064-121422086 CTTCTGCTTACATGAAATGCTGG + Intronic
937690842 2:124753255-124753277 CTTTTTAGCACATGGAATCCTGG + Intronic
938766622 2:134464200-134464222 CTGCTGGTCACATGGCATGCAGG + Intronic
939064120 2:137462055-137462077 TTTCTTTTAACATTGAATGCAGG - Intronic
940064971 2:149617247-149617269 TTCCTTCTCACATGAAAAGCAGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940591718 2:155737181-155737203 CTTCTTTTTACATGGAGTCCAGG - Intergenic
944133314 2:196370428-196370450 CTTCTCCTCAAGTGGAATGCAGG + Intronic
946961836 2:224993574-224993596 ATTCTTCTCATCTGAAATGCTGG - Intronic
947777983 2:232729977-232729999 CTTCTTCACTCCTGGAAGGCTGG + Intronic
948421302 2:237862027-237862049 CATCTTCACTCAGGGAATGCTGG + Intronic
948578661 2:238969945-238969967 CCTCCTCTCACATGGCATGAAGG - Intergenic
1170232841 20:14069371-14069393 CCTCTGCTCACATGTCATGCAGG - Intronic
1175326982 20:58136742-58136764 CTTCCTCTCCCATGAAAGGCAGG - Intergenic
1176428827 21:6564068-6564090 CACCTTCTCACATGGAATGAGGG + Intergenic
1179704317 21:43172384-43172406 CACCTTCTCACATGGAATGAGGG + Exonic
1183364019 22:37397748-37397770 CTTCTTCTTACATTGGATCCAGG + Intronic
1184435965 22:44476808-44476830 CCTCCTCCCACATGGGATGCTGG - Intergenic
950218212 3:11174826-11174848 CTTCTTCTCACCAGCACTGCTGG - Intronic
950850602 3:16058833-16058855 TTTCTTTTCACATGGATTACAGG + Intergenic
956292592 3:67677012-67677034 CTTCATCCCACATGGAAACCAGG - Intergenic
959926022 3:111922849-111922871 CATCTTCTCACAATGAAGGCGGG + Intronic
961895929 3:130167735-130167757 CTTCTTATCACAGGGAATGACGG + Intergenic
964625775 3:158758035-158758057 CTACATATCATATGGAATGCAGG - Intronic
965160722 3:165129706-165129728 CCTCTTCTCAAGTGGAATGAAGG + Intergenic
965466812 3:169039923-169039945 CTTCATAACACATTGAATGCTGG - Intergenic
966740835 3:183231883-183231905 CTGCTTCTGTCAAGGAATGCAGG + Intronic
967451016 3:189622797-189622819 CTTCCTCACACATGAAATGGAGG + Intergenic
967935984 3:194727977-194727999 CTTTTTGTCTCATGGAAAGCCGG - Intergenic
968232043 3:197009989-197010011 CTGCTTCTCACAGGGGACGCAGG - Intronic
969923546 4:10563531-10563553 TTTCTTCTCACATTAAATTCTGG - Intronic
970314538 4:14816739-14816761 CTTGTTCACACCTAGAATGCAGG - Intergenic
970651505 4:18183928-18183950 ATTTTTCTCACATGGAAGTCTGG + Intergenic
971290459 4:25333613-25333635 ATTTTTCTCAAATGGAATACAGG - Intronic
973754975 4:54065303-54065325 CATCTTCTAATATGGAATCCAGG - Intronic
973955887 4:56062670-56062692 CTTCTGCTGACGTGGAATCCAGG + Intergenic
975673396 4:76803781-76803803 CTTCATCACACAAGGAAGGCTGG - Intergenic
977407895 4:96623123-96623145 CTTCTTATCACATGGTATCAGGG + Intergenic
977758025 4:100696876-100696898 CTTTTTCTCTGATGAAATGCAGG - Intronic
978126351 4:105140431-105140453 ATTCTTCACACATGGAACTCAGG + Intergenic
978284157 4:107054947-107054969 TTTCTTCTCACTGGGGATGCAGG + Intronic
982138349 4:152294194-152294216 CTTCTGCTCTCATGGACCGCAGG + Intergenic
988178929 5:27764625-27764647 CTTCTTCAAACATGAAATCCTGG + Intergenic
990014176 5:51038581-51038603 CATCTCCTCACAGGGAATCCTGG + Intergenic
991531123 5:67615965-67615987 CTTTTTCATATATGGAATGCTGG - Intergenic
997467848 5:134100129-134100151 CTCCTTCTCACAAGGAGTGGAGG + Intergenic
998772703 5:145564655-145564677 CTTCTGCTCACATGAAGTCCAGG - Intronic
1000379446 5:160615610-160615632 CTTCTTCCAGCAGGGAATGCAGG + Intronic
1000542603 5:162558873-162558895 CTTCTTCTGCCATGGAAAGAAGG + Intergenic
1003483622 6:6555661-6555683 CTTCTTCTAGCATGGAATGGAGG + Intergenic
1004200803 6:13546189-13546211 CTGCTTCTGACATGGAAAACAGG - Intergenic
1006467718 6:34206094-34206116 AGTCTTCGCCCATGGAATGCAGG - Intergenic
1012862124 6:104572355-104572377 CTCTTTTTCACATGGGATGCCGG + Intergenic
1013905003 6:115205840-115205862 CTTCTCCTCAGAAGGAATGAAGG + Intergenic
1017484299 6:154888903-154888925 CTCCTTCTGACATGGAGTTCTGG - Intronic
1018500667 6:164407822-164407844 CTTCTTCTCCAAAGGAATGCAGG + Intergenic
1019150790 6:170004303-170004325 CTACTTCTCAGATGCAATGGGGG + Intergenic
1020326616 7:6979346-6979368 CTTCTTATCACAGGGAATGACGG + Intergenic
1020854895 7:13407154-13407176 CTTACTCTTACAAGGAATGCGGG - Intergenic
1023226282 7:37972532-37972554 TTTCTTCTCACATGGCCTGGAGG - Intronic
1024064286 7:45719631-45719653 CGTGTTCACACATGTAATGCAGG - Exonic
1026071882 7:67129106-67129128 CCTTTTCTTACATGGAAGGCCGG + Intronic
1026116613 7:67501310-67501332 CTTCTTCCTGCCTGGAATGCAGG - Intergenic
1026705025 7:72683148-72683170 CCTTTTCTTACATGGAAGGCCGG - Intronic
1029861933 7:103581767-103581789 CTTTTCCTCTCTTGGAATGCTGG + Intronic
1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG + Intronic
1034928785 7:155144078-155144100 CTCCTTTGCACATGGATTGCAGG + Intergenic
1035133572 7:156677635-156677657 TTTCTTCTCACATTAGATGCTGG - Intronic
1036370004 8:8154581-8154603 CTTCTTATCACAGGGAATGACGG - Intergenic
1036880888 8:12511049-12511071 CTTCTTATCACAGGGAATGACGG + Intergenic
1038620907 8:29142260-29142282 TTTCTTCTCACCTGGATTGCAGG + Exonic
1039002393 8:32995794-32995816 CTTCTTCTCAAGTGGAAGGAAGG + Intergenic
1042671814 8:71272404-71272426 CTTGTTCTCACATAAAATGAGGG - Intronic
1042701401 8:71618814-71618836 CTGCTTCCCACCTGGAATTCTGG - Intergenic
1046009889 8:108533502-108533524 CTTCTTCCCACATGGCGTGTTGG + Intergenic
1047183676 8:122613329-122613351 GCTCCTTTCACATGGAATGCAGG + Intergenic
1047932792 8:129747742-129747764 CCTCTTCTCACCTGGACAGCTGG - Intergenic
1048503183 8:134997118-134997140 CTTCTCCCCACATGGCCTGCAGG - Intergenic
1049355182 8:142184136-142184158 CCTCTACTCACCTGTAATGCTGG + Intergenic
1049440851 8:142608998-142609020 CTACTTCTCACATGAAAAGCTGG - Intergenic
1050012936 9:1203518-1203540 CTTCTTATCATATGCTATGCTGG + Intergenic
1051934041 9:22422628-22422650 CAAGTTCTCACATGTAATGCTGG - Intergenic
1053468814 9:38330541-38330563 CTTCATCACTCTTGGAATGCAGG - Intergenic
1056551353 9:87655688-87655710 CTCCTTCTCATATGGAAATCAGG + Intronic
1056825435 9:89873485-89873507 GCTCTTCTCACTTGGAAGGCTGG + Intergenic
1058966168 9:110040845-110040867 CTTGTTCACAGATAGAATGCTGG - Intronic
1059101205 9:111473631-111473653 CATCTTGGCACATGGATTGCGGG - Intronic
1059277497 9:113108721-113108743 CTTCTTTACTCTTGGAATGCAGG - Intergenic
1059278754 9:113115830-113115852 CTTCTTTACTCTTGGAATGCAGG + Intergenic
1059555531 9:115276718-115276740 CTTCTCCTCAAGTGGAAGGCAGG + Intronic
1060420788 9:123468210-123468232 ATTCTTGTCACATGTAATGTGGG + Intronic
1061242814 9:129384110-129384132 CTTCTTCTGACTTGGACTGGGGG + Intergenic
1061391986 9:130321801-130321823 CGTCTGCTCGGATGGAATGCCGG - Intronic
1061745826 9:132739759-132739781 CTTCTACTAACATGGAAGTCAGG + Intronic
1062198410 9:135287293-135287315 CTCCTTCTCACCAGGAACGCTGG - Intergenic
1062299733 9:135858926-135858948 CTTCTGCCCACATTGAAGGCAGG + Intronic
1187097121 X:16161055-16161077 CCTCTTCTCACCTGGAGTACAGG - Intergenic
1187674526 X:21702421-21702443 CCTCTTCTCCCACTGAATGCAGG + Intergenic
1188733153 X:33677308-33677330 TAACTTCTCAGATGGAATGCTGG - Intergenic
1188845247 X:35064579-35064601 CTACTTCACACATGTAAAGCTGG + Intergenic
1189541251 X:41992570-41992592 CTTCATCTCACAAGTAGTGCTGG - Intergenic
1189582367 X:42420408-42420430 CTAGTTCTCATATGGAATTCAGG - Intergenic