ID: 1031584658

View in Genome Browser
Species Human (GRCh38)
Location 7:123519736-123519758
Sequence TGTTAACTATAGTCACCGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 10, 2: 32, 3: 77, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031584658_1031584659 16 Left 1031584658 7:123519736-123519758 CCGTACGGTGACTATAGTTAACA 0: 1
1: 10
2: 32
3: 77
4: 177
Right 1031584659 7:123519775-123519797 AATAGCTAGAAGAAAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031584658 Original CRISPR TGTTAACTATAGTCACCGTA CGG (reversed) Intronic
900002162 1:20660-20682 TGTTAACTATAAGCTCAGTAGGG + Intergenic
900021883 1:191183-191205 TGTTAACTATAAGCTCAGTAGGG + Intergenic
900901234 1:5517491-5517513 TATTAACCATAGTCACCATGCGG - Intergenic
901009660 1:6192748-6192770 TGTTAACAATAGTCAACTTTTGG - Intronic
901272893 1:7966966-7966988 TGTTAACTATAGTCATTCTACGG + Intronic
907696551 1:56735895-56735917 TGTTAACTATAGTCATCCTATGG - Intronic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
909922043 1:81394262-81394284 TGTTATTTATAGTCACTATATGG + Intronic
911685244 1:100768301-100768323 TGTTAACCATAGTCATCCTTTGG - Intergenic
911685741 1:100775195-100775217 TATTAACTATAGTCACCATGTGG - Intergenic
912002864 1:104856661-104856683 TAATAACTAGAGTCACTGTAGGG + Intergenic
914963652 1:152231383-152231405 TGTTCACAATAGTCACAATATGG - Intergenic
914987177 1:152471154-152471176 TGTTAGCTATAATTACTGTAGGG - Intergenic
915006213 1:152639529-152639551 TGTTAAATATCATCAACGTAAGG - Intergenic
915918603 1:159957287-159957309 TATTAACTGTAGTCACCATATGG - Intergenic
917992142 1:180391617-180391639 TGTTGATTATAGCCACCCTAAGG - Intronic
918452581 1:184673753-184673775 TGTTGACTATAGTCACCATATGG + Intergenic
918955877 1:191206074-191206096 TGTTAACTGTAGTCATCCTACGG + Intergenic
919758848 1:201084228-201084250 TGTTAACTACTGTCACCACAGGG - Intronic
919870312 1:201815670-201815692 TATTAACTATAGTCACCATATGG - Intronic
921173989 1:212577464-212577486 TATTAACTATAGTCACTATGTGG + Intronic
922350507 1:224731390-224731412 TGTAAAATAGAGTCACCATATGG + Intronic
922990250 1:229901366-229901388 TGCTTGCTATAGTCACCTTAGGG - Intergenic
923043866 1:230339924-230339946 TATTAACTTTAGTCACCATGTGG - Intronic
923928443 1:238663446-238663468 TGTTTACTATATTCTCAGTATGG - Intergenic
924147885 1:241095826-241095848 TGTTAACTATAGTCATTCTACGG + Intronic
924313299 1:242769318-242769340 TGTTAACTATAGTCATCATGTGG - Intergenic
1063641267 10:7833018-7833040 TGTTGACTTTAGTCACCCTGTGG + Intronic
1064950497 10:20843881-20843903 AGTTAACCATATTCACCTTACGG + Intronic
1065412885 10:25449666-25449688 TATTAACTATAGTCACTATTTGG - Intronic
1066015503 10:31238933-31238955 TATTAACAATAGTCAAGGTATGG + Intergenic
1068631173 10:59299054-59299076 TATTAATTATAGTCACTGTGTGG - Intronic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1068892714 10:62164454-62164476 TCTTAACTATAGTCACCCTATGG - Intergenic
1069922940 10:71828317-71828339 TGTTCATTATAGTAACAGTATGG + Intronic
1071803217 10:89087820-89087842 TGTTAACTGCAGTCACTGTGTGG - Intergenic
1073537463 10:104290833-104290855 TATTTACTATAGTCACCATGTGG - Intronic
1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG + Intronic
1077801369 11:5541737-5541759 TATTAACTATAGCCACCATAGGG - Intronic
1077828154 11:5832651-5832673 TCTTAACTATATTCATCATACGG - Intronic
1077988558 11:7380371-7380393 TATTGACTATAGTCACCCTATGG - Intronic
1079385387 11:19974415-19974437 TATTAACTAAAGTCACATTAGGG - Intronic
1079929873 11:26544525-26544547 TATTAACTATAGTCACCATGTGG - Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1082690669 11:56299968-56299990 TGTTAACTGTAGTCATTGTACGG + Intergenic
1086067952 11:82766121-82766143 TGTTTATTATAGTCACCCTACGG - Intergenic
1086419555 11:86625190-86625212 TGTTAACGATAGTTACTGTCTGG - Intronic
1086636308 11:89090822-89090844 TATTAACTATAGTTACCTTATGG - Intergenic
1090384712 11:126350671-126350693 TATTAACTATTGTCACCATGTGG + Intergenic
1090442780 11:126737919-126737941 TGTTAACTACAGTCACCCTGTGG + Intronic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1091375227 12:20695-20717 TGTTAACTATAAGCTCAGTAGGG + Intergenic
1091559922 12:1604284-1604306 TGTTAACTATATTCGCCCTACGG - Intronic
1092118520 12:6026700-6026722 TGATAATTATAGTCACCCTGTGG - Intronic
1094420650 12:30267439-30267461 TATTGACTATAGTCACCCTGTGG - Intergenic
1094715345 12:33008618-33008640 CATTAACTATAGTCACCATGTGG + Intergenic
1095922072 12:47541657-47541679 TGTTCACTATACTTACCGTCTGG - Intergenic
1096486753 12:51987787-51987809 TATTGACTATAGTCACCCTGTGG - Intronic
1096566244 12:52482736-52482758 TATTAACTATAGTCATCCTACGG + Intergenic
1098303405 12:69077663-69077685 TATTAAGTATAGTCACCATTGGG - Intergenic
1098742281 12:74188564-74188586 TATTAACTATAGTCACCATGAGG - Intergenic
1100204536 12:92334025-92334047 TATTAACTATAGTCCTCCTATGG + Intergenic
1101477665 12:105065864-105065886 TGTTTACTATTGTCACTGCAGGG + Intronic
1105689195 13:22818904-22818926 TGTTAACCATAGTTACCCTCTGG + Intergenic
1106328287 13:28715642-28715664 TGTTAACTGTAGTCACCCTGTGG - Intronic
1106776208 13:33012418-33012440 TATTAACTATAGTCACCATGTGG - Intergenic
1107044877 13:35983550-35983572 TATTGACTATAGTCACCCTGTGG - Intronic
1107612693 13:42132327-42132349 TGTTAACTATAGTCATCCTACGG + Intronic
1107649695 13:42532468-42532490 TGTTAACTATAGTCACTCTATGG + Intergenic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1108134098 13:47336511-47336533 TATCATCTATAGCCACCGTAAGG - Intergenic
1108226015 13:48290089-48290111 TGTTAATTAAAGTCATCCTACGG + Intergenic
1108797855 13:54053967-54053989 TGTTAACTATATTCACCGTACGG - Intergenic
1109743601 13:66589319-66589341 TGTTACCTATAGTCATCGTAAGG - Intronic
1110024988 13:70525727-70525749 TATTAGCTATAGTCACCTTGCGG - Intergenic
1110937020 13:81304319-81304341 AGTTAACTTTAGTCACTGCATGG - Intergenic
1111202522 13:84959201-84959223 TGTCAACTATAGTCACGACATGG + Intergenic
1112202167 13:97287558-97287580 TGTTAAGTACAGTCATCCTATGG + Intronic
1112731971 13:102373344-102373366 TTTTAACTATAAACACTGTAAGG + Intronic
1112831882 13:103462945-103462967 TGTTAACTACAGTTGCCCTAAGG - Intergenic
1112944123 13:104905087-104905109 TGTTGACTATAGTCACTCTGTGG + Intergenic
1114679190 14:24470015-24470037 TGTTAACTATAGTTATCCTATGG - Intergenic
1115520672 14:34230173-34230195 TGTTAACTACAGTCATCCTATGG - Intronic
1116320965 14:43462255-43462277 TGTTAACTATCATCACCTTATGG + Intergenic
1116631865 14:47346026-47346048 TGTTAACTATAGTCATTTTACGG - Intronic
1117043473 14:51789149-51789171 TGTTAACTCTAGTCATCCTGTGG + Intergenic
1117760035 14:59017008-59017030 TATTAACTATAGCCACCATATGG - Intergenic
1117865753 14:60147319-60147341 TATTAACTGTAGTCACCATGCGG - Exonic
1118200665 14:63669063-63669085 TTTTAACTATATTCACTCTACGG + Intergenic
1118378388 14:65197246-65197268 TATTGACTATAGTCACCCTGTGG + Intergenic
1118757729 14:68857142-68857164 TATTGACTATAGTCACCCTGTGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121298046 14:92846081-92846103 TGTGAACTATAGTCACCCTATGG + Intergenic
1122755485 14:103975869-103975891 TGTCAACTGTAGTCACCCCACGG + Intronic
1123098712 14:105779411-105779433 TGTTAGTTATAGTCACCCTATGG + Intergenic
1127058811 15:55161163-55161185 TATTAACTATAGTCACCTTGCGG - Intergenic
1128593060 15:68919566-68919588 TTTTAATTATAGTTACTGTAAGG - Intronic
1129597729 15:76977722-76977744 TGTTAATTATAGTCATCCTAGGG + Intergenic
1130634925 15:85609176-85609198 TGCTAACTATAGTCACCCTTCGG + Intronic
1132451348 15:101970279-101970301 TGTTAACTATAAGCTCAGTAGGG - Intergenic
1136489196 16:30594421-30594443 TGTTAACTATAGTCATCCTACGG - Intergenic
1137256715 16:46781155-46781177 TATTAACTATAGTCATCCTACGG + Intronic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1138912782 16:61422434-61422456 TATTGACTATAGTCACCCTACGG + Intergenic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1139519334 16:67471560-67471582 TGTTAAATACAGTCACCCTATGG + Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1148196086 17:45714131-45714153 TATTAACTATAATCACCGAGTGG - Intergenic
1151034397 17:70781289-70781311 TGTTAACTATATTCACCCTATGG - Intergenic
1151394761 17:73815320-73815342 TGTTAACTGTAGTCATCCTATGG - Intergenic
1153169271 18:2296404-2296426 TGTTAACTATAGTCATTCTATGG - Intergenic
1157685931 18:49642460-49642482 TATTAACTGTAGTCACCATGTGG + Intergenic
1157879907 18:51311650-51311672 TGTTGATTGTAGTCACCCTATGG - Intergenic
1159297191 18:66508325-66508347 TATTAACTATAGTTACCATGTGG - Intronic
1159520896 18:69521753-69521775 TATTACCTATAGTCACTCTACGG - Intronic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1160633915 19:62268-62290 TGTTAACTATAAGCTCAGTAGGG + Intergenic
1165180974 19:33968807-33968829 TCTTGAGTATAGTCACAGTAGGG + Intergenic
1166285474 19:41824104-41824126 TGTTAAATATAGTCATCCTACGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
925455016 2:4008661-4008683 TGTTAACACTAGTCACCCAATGG + Intergenic
926371747 2:12185591-12185613 TATTAACTGTAGTCACCATGTGG - Intergenic
927257777 2:21055336-21055358 TGTTACCTGTAGTCATCCTAAGG + Intergenic
928787003 2:34900207-34900229 TATTAACTATAGTCTTCATATGG + Intergenic
929326457 2:40617493-40617515 TATTGACTATAGTCACCCTATGG + Intergenic
930772752 2:55144174-55144196 TGTTAACTATAGTCACGATGTGG - Intergenic
931436019 2:62247377-62247399 TGTTAACTATAATCACCCTAGGG + Intergenic
931736986 2:65204688-65204710 TATTAACCATGGTCACCATATGG - Intergenic
932998014 2:76881033-76881055 TGTCAACTATAGCCATCCTACGG - Intronic
933170163 2:79116034-79116056 TGGTTACTATAGTCACAGAAGGG - Intergenic
933647567 2:84824942-84824964 TGGTGACTATAGTCACCTTTAGG - Intronic
935136468 2:100307672-100307694 TATTAACTGTAGTCAACATATGG - Intronic
935461332 2:103338464-103338486 TGTTAACTATAGTCACAATAGGG + Intergenic
936567564 2:113592761-113592783 TGTTAACTATAAGCTCAGTAGGG - Intergenic
936891945 2:117381227-117381249 TGTTAACTACAGTCATCCTACGG + Intergenic
937225179 2:120364595-120364617 TGTTAACTGTGGGCACCTTATGG - Intergenic
938831935 2:135059676-135059698 TGTTAACTAAAGTCACTCTAAGG + Intronic
938957491 2:136312455-136312477 TGCTAACTATAGTCACTCTATGG + Intergenic
940570232 2:155422779-155422801 TGTTAACTATACTCATCCTACGG + Intergenic
940990955 2:160095881-160095903 TGTTCACTGTAGTCACCCTGTGG - Intergenic
941018475 2:160383690-160383712 TGTTAACTATAGTCATTCTATGG + Intronic
941037952 2:160588258-160588280 TTTTAACTATAGTCACTCTGTGG + Intergenic
941058859 2:160822181-160822203 TGTTGATTATAGTCACCCTGTGG + Intergenic
943338683 2:186650528-186650550 TATTAACTATAGTCAATCTACGG + Intronic
944573940 2:201073063-201073085 TTTTAACTATTGTCCCTGTAAGG - Intronic
944611032 2:201408042-201408064 TGCCAACTATAGCCACCCTATGG + Intronic
947997516 2:234541254-234541276 TATTAACTATGGTCACCATGTGG - Intergenic
1169360119 20:4941212-4941234 TGTTAATTATAGGCACAGTGTGG - Intronic
1169895032 20:10494922-10494944 TAATAACTATAGTCACCATGAGG - Intronic
1177911178 21:27034378-27034400 TGTTAACTGTAGTCATCCTCTGG + Intergenic
1177958610 21:27633034-27633056 TGTTAACTATAGTCATTTTATGG - Intergenic
1180569954 22:16705115-16705137 TGATAATTATAGTCACCCTGTGG - Intergenic
1181391247 22:22583181-22583203 TGTTAACCATAGTCACATTGCGG + Intergenic
1181848330 22:25731216-25731238 TGTTGTCTATAGTCACTTTATGG + Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1183025283 22:35060965-35060987 TATTAACTATAGTCACCATGTGG - Intergenic
949315737 3:2752662-2752684 TCTTAACTGTAGTCACCCTGTGG + Intronic
950225379 3:11229209-11229231 TGTTTACTATTGTCTCCTTATGG - Intronic
951652914 3:24972047-24972069 TATTAACTATATTCAGCCTATGG + Intergenic
952715700 3:36478290-36478312 AGTTAACAATAGTCACAATAGGG - Intronic
953280825 3:41554647-41554669 TGTTAACTGTAGGCACCATATGG - Intronic
954805691 3:53218728-53218750 TGTTAATTATGGTCAGCCTACGG - Intergenic
957407348 3:79789201-79789223 TTTTAACTATAGTTACGGAAAGG + Intergenic
958125877 3:89354070-89354092 TGTTAACTATATTCCCCCAAGGG + Intronic
958439717 3:94141278-94141300 TGTTAACTATAGTCATCCTATGG - Intergenic
958599346 3:96274960-96274982 TATTAGCTATATTCACCATACGG - Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
960927269 3:122807370-122807392 TGGTAACTATAGTCAGGGGAAGG + Intronic
961953691 3:130777381-130777403 TGTTAACTATAGTTACCCTACGG - Intergenic
963556805 3:146801418-146801440 TGGTAACCATAGTCACCATAGGG + Intergenic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
970074964 4:12207711-12207733 TGTTAATTATAGTCACAAGAAGG + Intergenic
970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG + Intergenic
972236643 4:37142256-37142278 TATTAACTGTAATCACCATATGG + Intergenic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
975954292 4:79818907-79818929 TTTTATCTTTAGTCAGCGTATGG - Intergenic
977782907 4:100999260-100999282 TGTTAATTATAGTCATCCAATGG + Intergenic
978081588 4:104599600-104599622 TATTAACTCTAGTTACCATATGG + Intergenic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
980664816 4:135917668-135917690 TGTCAACTATAGTCATCCTACGG - Intergenic
981180851 4:141742313-141742335 CATTAACCATAGTCACCATACGG - Intergenic
983100278 4:163617320-163617342 TGTTAGCTATATTCACTTTATGG - Intronic
983497917 4:168464759-168464781 TGTTAATTATATCCACCCTATGG + Intronic
983857051 4:172659425-172659447 TGTTAACTGTAGTCGTCCTATGG + Intronic
986160047 5:5219284-5219306 TGTTAACTATCGTCACCCTATGG + Intronic
987413668 5:17640207-17640229 TGTTAACTATAGTCACCATGTGG + Intergenic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
988111585 5:26829461-26829483 TGTCAACTGTAGTCACCCTATGG - Intergenic
988258708 5:28854151-28854173 TATTAACTATAGTCACCCTGTGG - Intergenic
988310061 5:29544791-29544813 TATTAACTATAGTCACCATGCGG + Intergenic
988394673 5:30681278-30681300 TATTAACTATAGTGACTATATGG - Intergenic
989210915 5:38858169-38858191 TGTTAGCTATAATCACCCTGTGG + Intronic
990783031 5:59387849-59387871 TGTTAACTATAGTCACCCTGAGG + Intronic
991602164 5:68363981-68364003 AGTTAACCATATTCACCCTATGG - Intergenic
993770831 5:91924109-91924131 TATTATCTATATTCACCATAAGG - Intergenic
994296134 5:98090551-98090573 TGTTAGCTATGGTCACCATGTGG + Intergenic
995192331 5:109330814-109330836 TGGTAGCTAAAGTCACCTTAGGG + Intergenic
995286415 5:110393991-110394013 TGTTGACTGTAGTCACCATGTGG + Intronic
995700615 5:114930740-114930762 TGATAGCTATAGTCAGCATAAGG - Intergenic
996373512 5:122777886-122777908 TGTTAATTTTAGTCAATGTATGG + Intronic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
1000399352 5:160809592-160809614 TGTTAACAATAGTCATCTTACGG + Intronic
1000573112 5:162939443-162939465 TGTTCACTATAGTCCCCCTACGG - Intergenic
1002839695 6:895079-895101 TGTTAACTGCAGTCATCCTATGG - Intergenic
1002982241 6:2149775-2149797 AGTTAAATATAGTCACCGTTGGG - Intronic
1004238436 6:13896583-13896605 TATTAACTGTAGTCATCCTATGG + Intergenic
1005530239 6:26697263-26697285 TATTAACTGTAGTCACCATACGG - Intergenic
1005540557 6:26804383-26804405 TATTAACTGTAGTCACCATACGG + Intergenic
1005776124 6:29132301-29132323 TGTTAACAACAGTCACGCTATGG - Intergenic
1006074496 6:31522487-31522509 TATTAAGTTTAGTCACCATAAGG - Intergenic
1007456678 6:41983532-41983554 TATTAACTATAATCACCATGTGG + Intronic
1008410349 6:51171453-51171475 TGTTAACTATAGACATCCTTGGG - Intergenic
1009011371 6:57846480-57846502 TATTAACTGTAGTCACCATACGG + Intergenic
1009405850 6:63311798-63311820 TATTAACTGTAGTCACCATGTGG + Intronic
1010632479 6:78215063-78215085 TTTTAACTATAGTCACCCTATGG + Intergenic
1011220154 6:85046495-85046517 TGCTAACTATGGTGACCATAAGG - Intergenic
1011362549 6:86543421-86543443 TGGGAACTATAGTTACCGTCTGG + Intergenic
1012230653 6:96757357-96757379 TATTAACTATAGTCACCATGTGG - Intergenic
1014345299 6:120262791-120262813 TATTAACTATAGCCACCATGTGG - Intergenic
1014353327 6:120371973-120371995 TGTTAACTATAGGCACAATGTGG - Intergenic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1016212871 6:141561878-141561900 TGCTGACTATAGTCACCCTGCGG + Intergenic
1016624522 6:146150610-146150632 TGTTAACTATAGTCACCCTGTGG + Intronic
1016642953 6:146371519-146371541 TATTGACTATAGTCACCCTACGG + Intronic
1020053118 7:5096292-5096314 TGTCAATTATAGTCACCCTATGG + Intergenic
1020442536 7:8233694-8233716 TGTTAACAATAGGCACCATGGGG - Intronic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1022124715 7:27344550-27344572 TATTAACTATAGTCACCCTGTGG + Intergenic
1023137472 7:37066577-37066599 TATTAACTATAGTCATCCTACGG - Intronic
1023462278 7:40411709-40411731 TGTTAACTATAGTCAACCAACGG - Intronic
1024108090 7:46113822-46113844 TATTGACTATAGTCACCCTGTGG + Intergenic
1024923210 7:54582988-54583010 TGCTAACTATAGTTATCCTATGG - Intergenic
1026395918 7:69954232-69954254 TGTTAACTATAGTCACTATGTGG - Intronic
1028205943 7:88017208-88017230 CGTTAAATATATTCACCCTACGG - Intronic
1028338475 7:89687929-89687951 TGTTAACTATAGTCAGCTCGTGG + Intergenic
1028434321 7:90783992-90784014 TGTTCACAATAGTCAAGGTATGG + Intronic
1030672626 7:112353869-112353891 TGTTACCTATAGTCATCCTACGG + Intergenic
1031559513 7:123221240-123221262 TGTTGACTATAGTCACTCTGTGG + Intergenic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1032661611 7:133990180-133990202 TGTTAAGTATAATTACCGTGTGG + Intronic
1033326881 7:140387160-140387182 CATTAACTATAGTCACCGGTAGG + Intronic
1033932614 7:146542997-146543019 TATTAACTATAGTCATCATGTGG - Intronic
1036089057 8:5645329-5645351 TGTTAACTATAGCCATCTTACGG - Intergenic
1038645418 8:29357586-29357608 TGTTAACTATATTCACCCTACGG + Intergenic
1038858737 8:31362014-31362036 TGTCAACCATGGGCACCGTAAGG - Intergenic
1039108685 8:34018490-34018512 TGTTAATTATAGTTATCATATGG + Intergenic
1039318482 8:36400149-36400171 TGTTAACTGTAGTCACCCTATGG - Intergenic
1039360099 8:36866807-36866829 TATTAACTATAGTCACTTTACGG - Intronic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040061296 8:43105234-43105256 TGTTAATTATAGTCATCCTATGG + Intronic
1040758708 8:50811894-50811916 TATAAACTATAGTCACCAGAAGG - Intergenic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1043115400 8:76246876-76246898 TGTTAACTATATTCACTGTATGG - Intergenic
1043384913 8:79738894-79738916 TGTTGACCATAGTCACCCTGTGG + Intergenic
1045932236 8:107640860-107640882 TCCAAACTATAGTCACCCTAAGG + Intergenic
1046889879 8:119411211-119411233 TGTTGACTATAGTCACCCTATGG + Intergenic
1049884970 9:20773-20795 TGTTAACTATAAGCTCAGTAGGG + Intergenic
1050201987 9:3155388-3155410 CGTTAACTATTGTCATCCTATGG + Intergenic
1051448352 9:17165918-17165940 TGTTAACTATAGAGACCTTTGGG + Intronic
1055082896 9:72284621-72284643 TTTTAATTATAGTCATCCTAGGG + Intergenic
1055484443 9:76743809-76743831 TGTTAACTTTAGTTACCTTGGGG + Intronic
1055727558 9:79247751-79247773 TATTAACAATAGTCACCATGCGG - Intergenic
1058213128 9:102198417-102198439 TATTAACTATGGCCACCATATGG - Intergenic
1059614645 9:115935754-115935776 TTTTAACTATAGTCACCGTATGG + Intergenic
1060164251 9:121396169-121396191 TGTTAATTATAGTCATCCTATGG + Intergenic
1185730719 X:2459209-2459231 TATTAACTATAATCACTGTGTGG - Intronic
1187818045 X:23255016-23255038 TGTTGAATATAGTAACCCTACGG - Intergenic
1188266564 X:28083493-28083515 TGTTAACTATAGTTGCCCCATGG - Intergenic
1188287638 X:28347622-28347644 TGTTAACTATAGTCACCATGAGG + Intergenic
1188500568 X:30821255-30821277 TGTTAACTATGGTCACCAGGTGG - Intergenic
1188662099 X:32773444-32773466 TGGTAACTATAATCACTCTAGGG + Intronic
1189541191 X:41991724-41991746 TGTTAGCTATAGTTGCCCTACGG - Intergenic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1190992083 X:55562448-55562470 TATTAACTATTGTCACCATGTGG + Intergenic
1191218538 X:57959966-57959988 TGTTAATTATAGTTACCCTATGG - Intergenic
1192475793 X:71441612-71441634 TATTAACTATAGTCATTCTACGG + Intronic
1193057745 X:77172523-77172545 TGTTAACTGTAGCCATCCTATGG - Intergenic
1193211788 X:78815309-78815331 CCTTAACTATAGTCACCTTCCGG - Intergenic
1193339749 X:80334293-80334315 TGTTAACAATATTCTCAGTATGG + Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1193822055 X:86177174-86177196 TGTTGACTGTAGTCACCCTGTGG + Intronic
1194232829 X:91345736-91345758 TGTTAGCTATAGTCATCCTATGG + Intergenic
1194363295 X:92982000-92982022 TATTGACTATAGTCACCTTGTGG - Intergenic
1196384714 X:115137095-115137117 TATTAACTATAGTCAACCTATGG + Intronic
1197272407 X:124439461-124439483 TGTTCACTATAGTCATTGAATGG - Intronic
1197538116 X:127717105-127717127 TATTAACCGTAGTCACCATAAGG - Intergenic
1198453106 X:136787531-136787553 TGTTAAACATAGTTACCATATGG + Intergenic
1198985685 X:142450176-142450198 TGTTAGCTGGAGTCACCATACGG + Intergenic
1199102204 X:143815626-143815648 TTTTGACTATAGTCACCTTGTGG - Intergenic
1199866013 X:151850882-151850904 TATTAACTATAGTCACCATACGG - Intergenic
1200335252 X:155344074-155344096 TATTAACTATAGTCATCACATGG + Intergenic
1200351216 X:155497147-155497169 TATTAACTATAGTCATCACATGG - Intronic
1200671536 Y:6098249-6098271 TATTGACTATAGTCACCTTGTGG - Intergenic
1200738019 Y:6821468-6821490 TGTTATCTACAGTCACCGTAAGG + Intergenic
1201725616 Y:17147480-17147502 GGTTGACTATAGTCACCCTGAGG - Intergenic
1202105969 Y:21366016-21366038 TGGTAACCATAGTCACCATAGGG - Intergenic
1202201666 Y:22357899-22357921 TGGTAACCATAGTTACCATAGGG + Intronic