ID: 1031584872

View in Genome Browser
Species Human (GRCh38)
Location 7:123522102-123522124
Sequence CAGAACCCTGAGAAATGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031584872 Original CRISPR CAGAACCCTGAGAAATGGTC TGG (reversed) Intronic
900264933 1:1752685-1752707 AAGAAGCGTGAGAAATGGGCTGG - Exonic
900375740 1:2353794-2353816 CAGCACCCTGGGACATGGTGGGG - Intronic
901268145 1:7928593-7928615 CAAAACCCTGACAAATGGGCCGG + Intronic
901586287 1:10296269-10296291 CAGAACCATCAGAAATTGTAAGG - Intronic
901613960 1:10522469-10522491 AACAACCCTGACAAATGATCAGG - Intronic
902369790 1:15998740-15998762 CAGGACCCTGGGAAATGCTGGGG - Intergenic
902776291 1:18676862-18676884 CAGCCCCCTGAGAAGGGGTCTGG - Intronic
909245290 1:73273631-73273653 CAGAATACTTAGAAATGGTTTGG - Intergenic
910764870 1:90771553-90771575 CAGACCCCTGTGAAATAGGCTGG - Intergenic
911342508 1:96656080-96656102 CAGAGCCCTCAGAAATAATCCGG + Intergenic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
914433476 1:147640408-147640430 CACAGCCCTGAGGAATGCTCCGG + Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
918346257 1:183610024-183610046 CAGACCCCTGAGAAAAGTTTGGG - Intergenic
919517421 1:198544029-198544051 CAAAACCCTAAGACTTGGTCTGG + Intergenic
921704508 1:218306460-218306482 CACAACCCTGAGAAATGGCCTGG + Intronic
921942995 1:220863019-220863041 AAGAACCTTGAAAAATGGTTAGG - Intergenic
922246024 1:223798428-223798450 TAGAACCTGGAGAAAGGGTCTGG + Exonic
923743707 1:236681340-236681362 CACAACCCTGAGAAATGGGCGGG + Intergenic
924548841 1:245055166-245055188 CATAGCCCTGAGAGATGGTCAGG + Intronic
924809526 1:247388975-247388997 CACAACCCTGTGAAAGGGTGGGG + Intergenic
1063513193 10:6667319-6667341 CAGTTCCCTGAGTGATGGTCTGG - Intergenic
1063741547 10:8827418-8827440 CACAAGCCTGAGAAAAGGTGTGG + Intergenic
1063876056 10:10479964-10479986 CAAAAGGCTGAGAAATGATCAGG - Intergenic
1065148187 10:22794293-22794315 CAGACCTCTGAGAAAAGTTCAGG + Intergenic
1065266995 10:23986939-23986961 GAGTGCCCTGAGAAATTGTCAGG + Intronic
1065361254 10:24891016-24891038 GGGAACCCTGAGAAATTCTCAGG + Intronic
1065995172 10:31052817-31052839 CATAACCCTGAGAAAAGGCTGGG - Intergenic
1067724875 10:48762491-48762513 CAGAACCATGAGAAATGACACGG - Intronic
1069172349 10:65248137-65248159 CAGAAGCATAAGAGATGGTCTGG + Intergenic
1071048793 10:81419776-81419798 GAAAACACTGAGAAATTGTCAGG + Intergenic
1072205102 10:93196720-93196742 CAGGACCATGAGAAATGGAGAGG - Intergenic
1073098236 10:100993439-100993461 CAGAACTCTGAGATTTGCTCAGG + Exonic
1074183384 10:111082062-111082084 GAGAGCCCTGAGAAATGATCTGG + Intergenic
1074776849 10:116773355-116773377 CAGAACCCTCAGCTCTGGTCTGG + Intergenic
1074893757 10:117757152-117757174 CAGAACCCTGACCAATGCTCAGG - Intergenic
1075795850 10:125118921-125118943 CACACCCCTGTGAGATGGTCAGG + Intronic
1076903960 10:133353103-133353125 CAGGAGCCTGAGACAGGGTCGGG + Intergenic
1078945042 11:16056307-16056329 AAGAATCCTTAGAAATGTTCAGG - Intronic
1080569653 11:33544315-33544337 CAGCACCCCAAGAAATGGACAGG + Exonic
1081853268 11:46288610-46288632 AAGAGCCCTGAGAAGTGGCCTGG - Intronic
1083251141 11:61468100-61468122 CAGAACCGTGAGAAAATTTCTGG - Intronic
1083576607 11:63796403-63796425 AAGAACCCAGAGCAATGGCCAGG - Intergenic
1083839887 11:65298339-65298361 CAGAACACTCAGACAGGGTCAGG + Exonic
1084146677 11:67268676-67268698 CAGAACCCTGAGAAACGAGATGG + Intronic
1087149133 11:94842843-94842865 CAGAACCCTGGGAGAGGGACAGG - Intronic
1087155259 11:94895678-94895700 CACAACTCTGAGAAATGATCTGG + Intergenic
1089785590 11:120904753-120904775 CAGAACACTGAGAGATGGAAGGG - Intronic
1089831048 11:121328583-121328605 CAGTACCCTAAGAAAGGGTGAGG + Intergenic
1090409225 11:126496311-126496333 CAGAACCCTGAACACTGGTAAGG + Intronic
1091501383 12:1021311-1021333 CACAATCCTGAAAAATGGCCTGG - Intronic
1091851021 12:3696948-3696970 CAGACCCCAGAGACTTGGTCAGG - Exonic
1091985847 12:4909865-4909887 CAGAAACCTGAGAAAGCGCCTGG - Intergenic
1092093891 12:5825839-5825861 CAGACCCCTCAGGAATGGTTTGG + Intronic
1092274318 12:7047865-7047887 CAGAACCCCAGGACATGGTCTGG + Intronic
1093391474 12:18629321-18629343 AAGGTCCCTAAGAAATGGTCAGG + Intronic
1093805719 12:23430886-23430908 CAAAACCCTGAGAAATGCATAGG + Intergenic
1093895509 12:24570524-24570546 CATAACCCTGAGAAACGGCCTGG - Intergenic
1095547218 12:43386885-43386907 AAGAACCTTGAGAAAAGGTTAGG - Intronic
1098985514 12:77007644-77007666 CTCAACCCTGAGAAACTGTCTGG - Intergenic
1100084032 12:90885616-90885638 AAGAACCCTGAGTAAAGGTAGGG - Intergenic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1102692351 12:114771294-114771316 CAGATCACTGAGAGATGTTCAGG + Intergenic
1105255025 13:18738724-18738746 CAGAAACCTGAGAAATGTGGAGG + Intergenic
1105513743 13:21073064-21073086 CTGCCCCCTGAGAAATGGTCTGG + Intergenic
1106488485 13:30193746-30193768 CATGCACCTGAGAAATGGTCTGG - Intergenic
1106587061 13:31066788-31066810 CAGGACCCTGAGAAAGGGCCAGG - Intergenic
1108582396 13:51838444-51838466 CACAACTCTGAGAAATGCCCTGG - Intergenic
1110959106 13:81598194-81598216 CAGATCCCTCATAAATGGTTTGG + Intergenic
1111290697 13:86166298-86166320 CAGATCCCTCATAAATGGTTTGG - Intergenic
1113572713 13:111370203-111370225 CAGGACCCTCAGAAAAGGCCTGG + Intergenic
1114139444 14:19894213-19894235 CAGACCCTGGGGAAATGGTCAGG + Intergenic
1115727058 14:36228511-36228533 CAGAGCTCAGAGAAATGCTCTGG - Intergenic
1117624376 14:57619784-57619806 AAGAACCCTGAAAAAAGGTTAGG + Intronic
1119506613 14:75178594-75178616 AAAAACCCTGTGAAATAGTCTGG + Intergenic
1121765133 14:96479501-96479523 CAGAAGGCTGGGAAAGGGTCTGG - Intronic
1123979230 15:25584171-25584193 CAGCAGCCAGAAAAATGGTCTGG + Intergenic
1124838042 15:33214697-33214719 CACAACCTTGAGAAAAGGCCTGG - Intergenic
1126734720 15:51719177-51719199 CACAACCCTGTGAGATGTTCAGG - Intronic
1128106831 15:65051472-65051494 CAGAGCCCTGAGGAATGGCCAGG - Intronic
1129368055 15:75069133-75069155 TAGAACTCTGAGAAATGACCTGG + Intronic
1129536838 15:76320149-76320171 CAGAACCCACATAAATGGTGTGG + Intergenic
1130062827 15:80581880-80581902 CAGGATCCTGAGAAATGCACAGG - Intronic
1130546247 15:84859074-84859096 CAGAAGCCTGAGATATAGGCAGG + Intronic
1133532019 16:6664039-6664061 TATCACCATGAGAAATGGTCAGG + Intronic
1133836951 16:9376090-9376112 CAGAAGCCTGAGAAAGGGGCAGG - Intergenic
1134390739 16:13817582-13817604 GAAAACCCTGAGAAATGGAGGGG + Intergenic
1136107545 16:28040861-28040883 CGGAACGCAGAGAGATGGTCTGG - Intronic
1137418404 16:48308021-48308043 CAGATCCCTGATAAATGGCTTGG - Intronic
1139347233 16:66311818-66311840 AGGACCCCTGAGGAATGGTCAGG - Intergenic
1139434176 16:66926587-66926609 CAGACCCCTGAGAGATGAGCAGG - Intergenic
1142269088 16:89079819-89079841 GAGAACCCTGGGACATGGTGAGG - Intergenic
1143223083 17:5278893-5278915 AAGGTCCCTCAGAAATGGTCAGG - Intergenic
1144038479 17:11387929-11387951 CAGCACCCAGACAAATGGGCTGG - Intronic
1144055027 17:11532950-11532972 CAGATCCCTGAGAAGTTCTCTGG - Intronic
1146205335 17:30900070-30900092 CAAAACCTTGCGAAATGGTCAGG - Intronic
1147288619 17:39423159-39423181 CAGAAATCTCAGAAATGGGCTGG - Intronic
1150829031 17:68502088-68502110 CAGACTCCTGAGAAGTGTTCAGG + Intergenic
1151244695 17:72785367-72785389 AAGAACCCAGAGAAAGAGTCGGG + Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152325122 17:79631585-79631607 CAATACCATGAGAAATGGTGGGG - Intergenic
1152559835 17:81072398-81072420 CTGGACCCTGAGAAGTGCTCAGG - Intronic
1153018844 18:608339-608361 CAGAACCCTGACAAATGAAGAGG + Intronic
1154436001 18:14341882-14341904 CAGAAACCTGAGAAATGTGGAGG - Intergenic
1155063283 18:22247352-22247374 CAGAACCCTGAGCACTGGTGTGG - Intergenic
1155623571 18:27808948-27808970 CAGTATCCTGAGAAAGGGTATGG + Intergenic
1156659179 18:39326460-39326482 CAGACCATTGAAAAATGGTCTGG + Intergenic
1159937356 18:74379898-74379920 AAGAACCCTGAGAAATGGGTAGG + Intergenic
1160339124 18:78071488-78071510 CAGACCCCGGCGAAATGGACAGG + Intergenic
1162078671 19:8205906-8205928 CTGAGCCCTGAGAAATGAGCGGG - Intronic
1163287283 19:16356628-16356650 CAGAACACTGACAAAAGGTGTGG + Intronic
1164562917 19:29306007-29306029 CACATCTCTGAGAAATGCTCTGG + Intergenic
1164895245 19:31871040-31871062 TAGAATTCTGAGAAATGGGCTGG - Intergenic
1165148036 19:33744467-33744489 CAGGACCCTGAGAAATGCGTTGG - Intronic
1167076585 19:47253693-47253715 CAGTAGCCTTAGAAATGGTAAGG + Intergenic
1167584747 19:50367859-50367881 CAAAACCCTTAGAAATCGGCTGG + Intronic
924965559 2:73407-73429 CAGCACCCTGAGAAGTGCCCCGG + Intergenic
925242324 2:2342203-2342225 CAGAGCCCTGGGGAATGGACAGG - Intergenic
925907463 2:8547862-8547884 CAAAAATCTGAGATATGGTCAGG + Intergenic
926803818 2:16686157-16686179 CAGAACCCTCAGAGAGGTTCAGG + Intergenic
927029647 2:19107162-19107184 GGGAACACAGAGAAATGGTCTGG + Intergenic
928986242 2:37185172-37185194 CAGACACATGAGAAATGGTAAGG + Intronic
929398251 2:41548620-41548642 CAGAACCCTGAAAAATCATCAGG + Intergenic
932022641 2:68103267-68103289 CAAAAACCTGAGAAAGGGTTGGG + Intronic
935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG + Intronic
935828317 2:106973599-106973621 CAGGACCCTGAGACATGGGATGG - Intergenic
937339025 2:121079193-121079215 CATAACTCTGATAAATGGCCAGG + Intergenic
937942656 2:127297981-127298003 CAGAAACCTCAGAATTGGCCGGG - Intergenic
939707291 2:145470891-145470913 CAGAGCCCTTAGAGATGCTCAGG - Intergenic
940036344 2:149315845-149315867 GAAAACCCTGTGAAATGGACTGG + Intergenic
941041687 2:160630202-160630224 CAGAACCTAGTGAAATGGTGTGG + Intergenic
941044111 2:160653241-160653263 CAGCTCTCTGAGAAATGGTCAGG - Intergenic
941663985 2:168225503-168225525 CCGAATCCTGAGATATGGTCTGG - Intronic
942042617 2:172081044-172081066 CAGAAACCTGAAGAATGGCCAGG - Exonic
942118700 2:172755101-172755123 TAGAACCCTGAGGAATACTCTGG + Intronic
945466123 2:210171731-210171753 CAAAACCCTGAGGAAAAGTCAGG + Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
945633663 2:212318944-212318966 GAGAACACTGAAAAATGGTGAGG - Intronic
946235565 2:218322878-218322900 CAGAAACCTGAGAGATCATCGGG - Intronic
946743181 2:222819990-222820012 AAGAAGCCTGAGGAATGGACTGG + Intergenic
947734324 2:232446820-232446842 CAGGACCCTCAGGAAGGGTCTGG - Intergenic
947864625 2:233387821-233387843 CAGCATCCTGAGAAATGGCAGGG + Intronic
948858639 2:240742390-240742412 CAAAACCCAGGGACATGGTCGGG - Intronic
1169187646 20:3632128-3632150 CAGAACCCTGAGATATCTACCGG - Intronic
1172350124 20:34232231-34232253 GACAATCCTGAGAAATGGCCTGG + Intronic
1172936209 20:38622407-38622429 CAAATCCTTGAGAAATGGTAGGG - Intronic
1173595791 20:44257825-44257847 CAGAACCCTGAGACAGGGGAAGG + Intronic
1173595803 20:44257859-44257881 CAGAACCCTGAGACAGGGGAGGG + Intronic
1173665853 20:44762428-44762450 CAAAAGCCTGAGAAATGGTGGGG + Intronic
1174175913 20:48644816-48644838 CAGAGCCCTGTGGAATGGGCAGG - Intronic
1174540785 20:51287723-51287745 AAGAACCCTGAGATATGATCAGG + Intergenic
1176841035 21:13843753-13843775 CAGAAACCTGAGAAATGTGGAGG + Intergenic
1177233936 21:18361464-18361486 AGGAGCCCTGAGAAGTGGTCTGG + Intronic
1178270305 21:31183392-31183414 CAGCAGCCTGAGAAATGGAGAGG + Intronic
1179949360 21:44700978-44701000 CAGAACCCTGGGAAAGGGTGTGG + Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181909937 22:26230702-26230724 CAGAAGCCTGAGAAAAGGGAGGG + Intronic
1181961760 22:26627153-26627175 AAGAACCCTGAAAAATGGGTAGG + Intronic
1183121860 22:35736330-35736352 CACAACCCCCAGAAATGGCCTGG + Intergenic
950201929 3:11050642-11050664 CAGAACCCTAAGGACAGGTCAGG + Intergenic
951575098 3:24105351-24105373 CACAACCCTGACAAATAGCCTGG + Intergenic
951804705 3:26631448-26631470 GAGAACCATGGGAAAAGGTCAGG + Intronic
954833175 3:53440694-53440716 AAGAACTCAGAGAAATGGCCAGG - Intergenic
959245642 3:103863719-103863741 CAGATCCCTCATAAATGGTTTGG + Intergenic
960595110 3:119401263-119401285 AAGAAGCCTGAGAAAAGGTGGGG + Intronic
960679099 3:120228212-120228234 CACAACCCTGAGAAATGGCCTGG - Intronic
962463148 3:135633001-135633023 CACAACCCTGTGAGATAGTCTGG + Intergenic
962479464 3:135785950-135785972 CAGAGCCCAGAGAGATGGCCTGG + Intergenic
962664668 3:137642062-137642084 CAGAGTCCTGAGAAAAGGTGAGG - Intergenic
963985775 3:151592644-151592666 TACAACCCTGAGAATTGGTTTGG + Intergenic
963989428 3:151635948-151635970 CACGACTCGGAGAAATGGTCTGG - Intergenic
964663164 3:159143313-159143335 AAGAACCCTGAGAATTTGTATGG - Intronic
965364547 3:167782785-167782807 CAGAACCTTGAGAAGTGCTTTGG + Intronic
966376245 3:179298516-179298538 TATCACCCTGAGAAATGGCCTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968317127 3:197734507-197734529 GAGAAAGCTGAGAAATGGACAGG - Intronic
968739683 4:2321103-2321125 CAGGCACCTGAGACATGGTCTGG - Intronic
969260925 4:6033001-6033023 CTGAACCCTCAGAGAGGGTCAGG + Intronic
971597813 4:28554175-28554197 CAGCACCCTGTGATATGGTAAGG - Intergenic
973543788 4:51959998-51960020 CATAACCCTGAGGAGTGGCCAGG - Intergenic
974451450 4:62067222-62067244 TAGAACCCTTTGAAATGATCTGG + Intronic
974835789 4:67249156-67249178 CACAACTCTGAGAAACGTTCAGG + Intergenic
976114222 4:81709954-81709976 CAGTACCCTGAGGAGTGGTAAGG - Intronic
978359678 4:107916932-107916954 TACAATCCTGAGAAATGGCCTGG - Intergenic
978436381 4:108689168-108689190 CATGATCCTGAGCAATGGTCTGG + Intergenic
979571583 4:122232788-122232810 CACAACCCTGTGAAATAGCCTGG + Intronic
979682487 4:123477144-123477166 CAGATCCCTCATGAATGGTCTGG + Intergenic
981298540 4:143160631-143160653 CTCAACCTTGAGAAATGTTCTGG - Intergenic
982012006 4:151114617-151114639 CACAGCCCTGAGAAGTGGCCAGG - Intronic
984200146 4:176709535-176709557 CTGAACTCTGAGAAATGGAGAGG + Intronic
984331474 4:178325849-178325871 CAGAACCCTGATAAATTTTTAGG + Intergenic
984576966 4:181462205-181462227 AGGAACCCTGAGAAATAGCCGGG + Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
985957720 5:3277175-3277197 CAGAACTCTGAGAAAGAGACGGG + Intergenic
986272522 5:6246285-6246307 GAGAAGCCTGAGGAGTGGTCTGG + Intergenic
990225022 5:53640670-53640692 CAGATCCCTCACAAATGGTCTGG - Intronic
990945592 5:61245857-61245879 CAGAAGACTGAGAAATTCTCTGG + Intergenic
991231783 5:64342054-64342076 CAGAACCCTGAGAAAGAGCAGGG + Intronic
994188342 5:96839886-96839908 CAGAGACCTGAGAAATATTCTGG - Intronic
995168955 5:109083696-109083718 TACATCCCTGAGAAATGGCCTGG - Intronic
998185293 5:139974711-139974733 CAGAGGCCTCAGAAATGGCCTGG + Intronic
998264648 5:140658862-140658884 GAGAATCTGGAGAAATGGTCAGG + Intronic
1001512122 5:172331286-172331308 CTCCACCCTGAGAAATGGCCGGG - Intronic
1002541418 5:179908574-179908596 CAGAATTCTGAGAACTGGCCGGG - Intergenic
1003231496 6:4257855-4257877 CTTTACCCTGAGAAATGCTCAGG - Intergenic
1003395680 6:5750225-5750247 CAGAAACCTGAGGAATGAGCGGG + Intronic
1005694797 6:28341837-28341859 AACAACCCTGAGAAATGGCGTGG + Intronic
1007376527 6:41460529-41460551 CAGAACCCTGGTAATTGCTCTGG + Intergenic
1009822341 6:68819278-68819300 GAGAGCGATGAGAAATGGTCAGG - Intronic
1010069366 6:71725387-71725409 CAAATCCCTAAGAAATGTTCAGG - Intergenic
1012050692 6:94339882-94339904 TATAACCCTAAGAAATGGCCAGG + Intergenic
1013261954 6:108452955-108452977 CACAACCTTGAGAAATGGTTAGG + Intronic
1016085417 6:139907540-139907562 CAGAACCCTCAGGAATGGCTTGG + Intergenic
1017432459 6:154384577-154384599 CAGAAACCTGGGAAAATGTCTGG - Intronic
1017878514 6:158543568-158543590 CAGAAGCCGGAGAAAAGGCCTGG - Intronic
1019215266 6:170439049-170439071 CAGAAGGCTGAGGGATGGTCTGG + Intergenic
1022496211 7:30854750-30854772 CACAGCCCTGGGAAATGATCAGG + Intronic
1022868728 7:34452023-34452045 AAGAACCCAGAGAAAAGGACAGG + Intergenic
1023683871 7:42715637-42715659 CAGGAACCTGAGATGTGGTCTGG - Intergenic
1024099191 7:46011639-46011661 CAAAATACTGAGAAATAGTCAGG + Intergenic
1024392471 7:48831465-48831487 CAGAAACCCTAAAAATGGTCTGG + Intergenic
1025621916 7:63180854-63180876 CTGAATCCTGAGAAATAGTCAGG + Intergenic
1027198665 7:76048447-76048469 GGGAACCCTGACAAATGGACCGG - Intronic
1027647583 7:80822854-80822876 CTAAACCCGGTGAAATGGTCAGG + Intronic
1029306834 7:99625756-99625778 CAGAACAGTCAGAAATGGCCAGG - Intronic
1029437702 7:100572328-100572350 CAGCACCCTGAGAACTGCTGGGG + Exonic
1029489695 7:100863851-100863873 CAGAACCCTGGGAAATACTGAGG + Intronic
1030838064 7:114312868-114312890 CACAACCCTGATAAATGGCCTGG + Intronic
1031584872 7:123522102-123522124 CAGAACCCTGAGAAATGGTCTGG - Intronic
1031943322 7:127812761-127812783 CACAACCCTGATAAATAGCCAGG - Intronic
1032168393 7:129563769-129563791 CAGAACCCTGTGAATTTGTTAGG - Intergenic
1032475597 7:132209513-132209535 CAGAAATCTGAGAAATAGCCTGG + Intronic
1033019228 7:137705880-137705902 TATAACCCTGAGAGAGGGTCAGG + Intronic
1034990400 7:155544354-155544376 CAGAGCCCTGAGGAAGGGGCTGG - Intergenic
1035713077 8:1733445-1733467 CACAGCCCTGAGAGATGGTCCGG + Intergenic
1035913635 8:3595998-3596020 CAAAGCCCTGATAAATTGTCAGG - Intronic
1035951304 8:4024595-4024617 AAGAACCTTAAGAAATGGGCAGG - Intronic
1039327340 8:36500045-36500067 CAAAACTCTGAGAGATGGTGGGG + Intergenic
1039553970 8:38463734-38463756 AAGAACCCTGAGAAAATTTCTGG + Intronic
1039615806 8:38954130-38954152 CAGAACCCTCAGATATCATCAGG + Intronic
1041027710 8:53703906-53703928 CAGAACCCTGACAGAGGCTCCGG + Intergenic
1041894278 8:62905942-62905964 CACAACGCTGAGAAATTCTCAGG - Intronic
1042533991 8:69840699-69840721 CACAACTCTGAGAAACGGCCTGG - Intergenic
1042715144 8:71764344-71764366 CTGAATCCCGAGAAATGGTACGG + Intergenic
1042908106 8:73795277-73795299 CAGATCCCTCAGGAATGGTTTGG + Intronic
1046849723 8:118958418-118958440 CAAAACCCTGTTAAGTGGTCTGG - Intergenic
1049435736 8:142585462-142585484 CAGAAACCTGAGAAATGCAAGGG - Intergenic
1049588175 8:143441409-143441431 CAGAGCCCTGAGCCATGGCCTGG - Intronic
1050899611 9:10929923-10929945 AAGAAACCTGAGACATGGTCAGG - Intergenic
1051243008 9:15080177-15080199 CACAACCTTGGGAAATGGCCTGG + Intergenic
1052738602 9:32371818-32371840 CACAACCCTGAGAAATGGCCTGG + Intergenic
1054789489 9:69242328-69242350 CACAACGCTGGGAAATGTTCAGG - Intronic
1056728618 9:89144094-89144116 CATGAACCTGAGAAATGGTAGGG + Intronic
1057754388 9:97820223-97820245 CAGAACCCTGAGACATGAGTGGG - Intergenic
1058014987 9:100021160-100021182 CACAACTCTGAGAAATGGCCTGG - Intronic
1058071517 9:100605430-100605452 AAGAACACTAAGAAATGGTAAGG - Intergenic
1058093136 9:100828645-100828667 AAGAACCTTGAGAAAAGGTTAGG - Intergenic
1058987152 9:110219042-110219064 CAGAAGCCTGTGAAGTGGCCTGG + Intergenic
1061323801 9:129849778-129849800 CAGAACTGTGTGAAATGCTCTGG + Intronic
1062457097 9:136644995-136645017 CAGAGCCCTGGGAAAGGGTCAGG - Intergenic
1203494549 Un_GL000224v1:138756-138778 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1203507168 Un_KI270741v1:80631-80653 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1187824758 X:23323844-23323866 CAGCATCCTGGAAAATGGTCTGG - Intergenic
1188293874 X:28421453-28421475 CAGATCCCTCATAAATGGTTTGG - Intergenic
1190047622 X:47125341-47125363 CACAACCCTGAGAAATGGCTGGG + Intergenic
1190273829 X:48887448-48887470 CAGAACCCTCTGAAATGCCCAGG + Intergenic
1190774375 X:53540897-53540919 CAGAACCTTGAAGAATAGTCAGG - Intronic
1192477952 X:71459750-71459772 CAGCACCCTCAGAACTGGACTGG + Intronic
1192661330 X:73045908-73045930 CAGACCCCTCAGGAATGGTTTGG - Intergenic
1193021667 X:76799132-76799154 CAAAACCATGACAAATGGTGGGG - Intergenic
1197585227 X:128338603-128338625 CAGTTCTCTGAGAAATGCTCAGG + Intergenic
1197830286 X:130634780-130634802 CAGAACCCTTAGAAATGCCAAGG + Intronic
1198261852 X:134972098-134972120 CACAACCCTGATAAATGGCCAGG - Intergenic
1198282103 X:135152545-135152567 CAGCAACCTGAGAAAGGATCTGG + Intergenic
1198284406 X:135175532-135175554 CAGCAACCTGAGAAAGGATCTGG + Intergenic
1198288856 X:135219977-135219999 CAGCAACCTGAGAAAGGATCTGG - Intergenic
1198513081 X:137373950-137373972 AACAGCCCTGAGAAATGGGCAGG + Intergenic
1201751155 Y:17433329-17433351 AACAACCATGAGAAATGCTCCGG - Intergenic