ID: 1031589632

View in Genome Browser
Species Human (GRCh38)
Location 7:123573687-123573709
Sequence CCTGGAAGGATACAGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031589632_1031589636 -7 Left 1031589632 7:123573687-123573709 CCTGGCTTCTGTATCCTTCCAGG No data
Right 1031589636 7:123573703-123573725 TTCCAGGAGTGGAGTAAATTTGG 0: 1
1: 0
2: 0
3: 25
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031589632 Original CRISPR CCTGGAAGGATACAGAAGCC AGG (reversed) Intronic