ID: 1031592377

View in Genome Browser
Species Human (GRCh38)
Location 7:123609446-123609468
Sequence GACACTGATGTGACAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031592375_1031592377 13 Left 1031592375 7:123609410-123609432 CCTAAAGGACAGAATCTCTTGCT 0: 1
1: 0
2: 0
3: 22
4: 225
Right 1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG 0: 1
1: 0
2: 2
3: 36
4: 428
1031592374_1031592377 14 Left 1031592374 7:123609409-123609431 CCCTAAAGGACAGAATCTCTTGC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG 0: 1
1: 0
2: 2
3: 36
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031592377 Original CRISPR GACACTGATGTGACAGGTGC TGG Intronic
900339122 1:2179518-2179540 CCCACTGATGTGAAAGGTGGTGG + Intronic
900552852 1:3265182-3265204 GACAGGGATGAGACAGGAGCAGG + Intronic
900741957 1:4335869-4335891 GAGAATGGTGTGACAGGAGCTGG - Intergenic
900836255 1:5006689-5006711 GCCACTGATCTGACAGGAGGTGG + Intergenic
901304513 1:8223005-8223027 GCCACTGATCTGACAGGAGGTGG - Intergenic
902066584 1:13693251-13693273 GCCACTGATCTGACAGGAGGCGG + Intergenic
902104219 1:14020156-14020178 GCCACTGATCTGACAGGAGGTGG + Intergenic
902821782 1:18947849-18947871 GGCAATATTGTGACAGGTGCTGG + Intronic
903088389 1:20885079-20885101 GCCACTGATCTGACAGGAGGCGG + Intronic
903441696 1:23393176-23393198 GTCACTGATCTGACAGGAGGCGG + Intronic
903841713 1:26247021-26247043 GCCACTGATCTGACAGGAGATGG - Intronic
904564609 1:31421102-31421124 GCCACTGATCTGACAGGAGGCGG - Intronic
904614099 1:31740565-31740587 GTCACTGAAGTGTCAGGAGCTGG + Intronic
905199959 1:36308492-36308514 GACACTCAGGTGGCAGGGGCAGG + Intronic
905865509 1:41374266-41374288 GTCACTGCAGTAACAGGTGCTGG + Intronic
906639061 1:47430603-47430625 GCCACTGATCTGACAGGAGGCGG - Intergenic
906761217 1:48381095-48381117 GCCACTGATCTGACAGGAGGTGG + Intronic
907301335 1:53488382-53488404 GAGAGTGATGTGAGAGGTGCTGG - Intergenic
907926065 1:58956241-58956263 GCCACTGATCTGACAGGAGGCGG - Intergenic
909447807 1:75767026-75767048 GCCACTGATTTGACAGGAGGTGG - Intronic
910315217 1:85874889-85874911 GCCACTGATCTGACAGGAGGTGG - Intronic
910946716 1:92600721-92600743 GCCACTGATCTGACAGGAGGTGG + Intronic
910953754 1:92679081-92679103 GCCACTGATCTGACAGGAGGTGG - Intronic
912216402 1:107618112-107618134 GCCACTGATTTGACAGGAGGGGG + Intronic
913179089 1:116302120-116302142 GAGAGAGATGTGACAGGTGAAGG + Intergenic
913226011 1:116698950-116698972 GATTCTGATGTGACTGGTTCAGG - Intronic
915775510 1:158480656-158480678 AACACTGAGGTGAGAGGCGCAGG - Exonic
916236526 1:162594346-162594368 GCCACTGATCTGACAGGAGGTGG + Intronic
916997541 1:170316535-170316557 GACACTCATGTGAAAGGTGCAGG - Intergenic
917543695 1:175940130-175940152 GCCACTGATCTGACAGGCGGCGG + Intergenic
917826702 1:178829404-178829426 GCCACTGATTTGACAGGAGATGG - Intronic
918517311 1:185377134-185377156 GACACTGAGGGGTCAGCTGCTGG + Intergenic
921759403 1:218895661-218895683 GAAACAGATGAGACAGGTGCAGG + Intergenic
922214443 1:223509107-223509129 GACCCAGATGTGACAGGTGGGGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922607875 1:226902247-226902269 GCCACTGATTTGACAGGAGGCGG + Intronic
923080161 1:230645882-230645904 GCCACTGATCTGACAGGAGGCGG + Intronic
923287022 1:232506038-232506060 GTCACTAATGTGACAGTTGTAGG - Intronic
924895363 1:248332838-248332860 TCCACTGATGTGGCAGGGGCTGG - Intergenic
1062786378 10:268776-268798 GACACTGGTGTGACTGGAGAGGG + Intergenic
1063330861 10:5157818-5157840 GACACAGATGTGAAGGATGCAGG + Intergenic
1063438305 10:6052264-6052286 GTCCCTGATGTGAGATGTGCTGG + Intronic
1063594344 10:7420187-7420209 GTCACTGATCTGACAGGAGGTGG - Intergenic
1064368183 10:14727112-14727134 CACACTGATCTGACAGGAGGTGG + Intronic
1064781254 10:18841289-18841311 GCCACTGATGTGACAGGAGGTGG + Intergenic
1064810275 10:19189340-19189362 GACACTAATGGGACAGTTCCAGG - Intronic
1065947822 10:30623529-30623551 GCCACTGATCTGACAGGAGGTGG - Intronic
1066640452 10:37549939-37549961 GACGCTGATTTGACAGGAGGTGG + Intergenic
1066792576 10:39082030-39082052 TTCACTGATGTGGCAGATGCAGG + Intergenic
1067324965 10:45258909-45258931 GACAATGAGGTGAGAGGAGCAGG - Intergenic
1067374444 10:45714448-45714470 GCCACTGATCTGACAGGAGGAGG - Intergenic
1067379235 10:45757811-45757833 GCCACTGATCTGACAGGAGGAGG + Intronic
1067882257 10:50056090-50056112 GCCACTGATCTGACAGGAGGAGG - Intergenic
1067886937 10:50098474-50098496 GCCACTGATCTGACAGGAGGAGG + Intronic
1068415950 10:56723159-56723181 GCCACTGATCTGACAGGAGGTGG - Intergenic
1068669786 10:59710733-59710755 TACACTGAAGTGACAGGTCCTGG + Intronic
1068957109 10:62828079-62828101 GCCACTGATCTGACAGGAGGTGG - Intronic
1068987541 10:63121075-63121097 GCCACTGATCTGACAGGAGGCGG - Intergenic
1070842712 10:79498699-79498721 GTCACTGATCTGACAGGAGGTGG - Intergenic
1071909162 10:90211392-90211414 GTCACTGATCTGACAGGAGGTGG + Intergenic
1072483052 10:95828179-95828201 GCCACTGATCTGACAGGAGATGG - Intronic
1073045725 10:100637179-100637201 GATGCTGATGCGACAGGTCCAGG - Intergenic
1073659951 10:105463801-105463823 GTCACTGATCTGACAGGAGGTGG - Intergenic
1074177456 10:111023389-111023411 GACTCAGATATGACAGATGCTGG + Intergenic
1075290129 10:121222216-121222238 GCCACTGATCTGACAGGAGGGGG - Intergenic
1075509686 10:123061247-123061269 GACAATGATGTGACAAGCCCAGG + Intergenic
1075880633 10:125847886-125847908 GCCACTGATCTGACAGGAGGTGG + Intronic
1075927854 10:126267597-126267619 GCCACTGATCTGACAGGGGGCGG + Intronic
1077643442 11:3902576-3902598 GCCACTGATATGACAGGAGGCGG + Intronic
1077819272 11:5720013-5720035 GACACAGATGTGTGTGGTGCAGG - Intronic
1077845024 11:6014139-6014161 GACAATGATGTCAGATGTGCTGG - Intergenic
1078592308 11:12653850-12653872 GCCACTGATCTGACAGGAGGTGG + Intergenic
1078731819 11:13981842-13981864 GACTCTGATGTCCCAGGAGCAGG - Intronic
1079318849 11:19432996-19433018 AAAACTGAAGTGACAGGAGCTGG - Intronic
1079402875 11:20119880-20119902 GACAATGATCTGTCTGGTGCAGG + Intronic
1079405779 11:20144485-20144507 GACACTGATCTTACAGGAGGTGG + Intergenic
1079582918 11:22088455-22088477 AACACTAATGTGACAGAGGCTGG - Intergenic
1079916571 11:26375261-26375283 GCCACTGATCTGACAGGAGGTGG + Intronic
1081176516 11:39933668-39933690 GCCACTGATCTGACAGGGGGTGG + Intergenic
1082818591 11:57528009-57528031 CACACAAAAGTGACAGGTGCAGG + Intergenic
1083018201 11:59478145-59478167 CACAGTGATGTGGGAGGTGCAGG - Exonic
1083019499 11:59492367-59492389 CACAGTGATGTGGGAGGTGCAGG - Intergenic
1083023747 11:59532500-59532522 CACAGTGATGTGGGAGGTGCAGG - Intergenic
1085556845 11:77430923-77430945 GCCACTGATCTGACAGGAGGTGG - Intronic
1087060561 11:93973022-93973044 GCCACTGATCTGACAGGAGGTGG - Intergenic
1087691692 11:101327605-101327627 GCCACTGATCTGACAGGAGGTGG + Intergenic
1087734692 11:101818807-101818829 GACACTGATGCTACAGATCCTGG + Intronic
1088644631 11:111907873-111907895 ACCACTGATGTGACAGGAGGTGG - Intergenic
1091513976 12:1159388-1159410 GCCACTGATCTGACAGGAGGTGG + Intronic
1091942576 12:4501516-4501538 GCCACTGATCTGACAGGAGGCGG - Intronic
1092392294 12:8091563-8091585 GCCACTGATCTGACAGGAGGCGG + Intronic
1092752118 12:11728406-11728428 GCCACTGATCTGACAGGAGGCGG - Intronic
1093065894 12:14657595-14657617 ACCACTGATGTGACAGGAGGTGG - Intronic
1093411918 12:18877761-18877783 GCCACTGATCTGACAGGAGGTGG + Intergenic
1094747628 12:33363962-33363984 GCCACTGATCTGACAGGAGGTGG - Intergenic
1095589671 12:43889468-43889490 GCCACTGATCTGACAGGAGGTGG + Intronic
1096794129 12:54063589-54063611 ACCACTGATGTCACTGGTGCCGG + Intergenic
1097742839 12:63264857-63264879 GCCACTGATCTGACAGGAGGCGG - Intergenic
1098121257 12:67242059-67242081 CTTACTGATGTGCCAGGTGCTGG + Intergenic
1099306729 12:80966221-80966243 GCCACTGATCTGACAGGGGGTGG - Intronic
1099467942 12:83009958-83009980 GCCACTGATCTGACAGGAGATGG + Intronic
1100506401 12:95224978-95225000 GCCACTGATCTGACAGGAGGCGG + Intronic
1101439474 12:104692699-104692721 GCCACTGATATGACAGGAGGTGG - Intronic
1101708755 12:107245502-107245524 AACACTAGTGTGTCAGGTGCTGG - Intergenic
1102020226 12:109677254-109677276 GCCACTGATGGGACAGGCCCTGG - Intergenic
1102431386 12:112886490-112886512 GCCACTGATCTGACAGGAGGCGG + Intronic
1102966157 12:117128173-117128195 GTCACAGATGTGACAGGTGATGG - Intergenic
1104476784 12:129077105-129077127 GAGCATTATGTGACAGGTGCAGG + Intronic
1105324531 13:19358125-19358147 GAAACTGAAGTCACAGGAGCAGG + Intergenic
1105868778 13:24485591-24485613 GAAACTGAAGTCACAGGAGCAGG - Intronic
1106007058 13:25780800-25780822 GCCACTGATCTGACAGGAGGCGG + Intronic
1106066283 13:26354579-26354601 GCCACTGATCTGACAGGAGGCGG - Intronic
1106701034 13:32228869-32228891 CCCACTGATGTGACAGTTGATGG + Intronic
1106985530 13:35343645-35343667 GCCACTGATCTGACAGGAGGCGG - Intronic
1107437799 13:40395960-40395982 GCCACTGATCTGACAGGAGGCGG + Intergenic
1108405158 13:50093512-50093534 GACACTGAAGTGGGAGGTGATGG + Intronic
1110471374 13:75863746-75863768 GCCACTGATCTTACAGGTGGCGG - Intergenic
1113126286 13:106982919-106982941 GCCACTGATCTGACAGGAGGCGG - Intergenic
1113300342 13:109012369-109012391 GCCACTGATTTGACAGGAGCTGG - Intronic
1114435462 14:22702854-22702876 GACAATGATGTGGGAGGAGCAGG - Intergenic
1114528068 14:23378653-23378675 CACACTGATTTCACAGCTGCAGG + Intronic
1114890453 14:26915178-26915200 GCCACTGATCTGACAGGAGGCGG + Intergenic
1115275953 14:31608739-31608761 GCCACTGATCTGACAGGAGGCGG + Intronic
1115370216 14:32604969-32604991 GTCAGTGAGGGGACAGGTGCGGG - Intronic
1115444322 14:33471897-33471919 GCCACTGATCTGACAGGAGCTGG - Intronic
1116774812 14:49167170-49167192 GACACTGATATGGCAGATTCAGG - Intergenic
1117088829 14:52228948-52228970 GCCACTGATCTGACAGGAGATGG + Intergenic
1117559152 14:56918086-56918108 GCCACTGATCTGACAGGAGGCGG + Intergenic
1117851498 14:59975993-59976015 GCCACTGATGTGACAGGAGGCGG - Intronic
1118513808 14:66505706-66505728 GCCACTGATCTGACAGGAGGCGG - Intergenic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1119260366 14:73234725-73234747 GCCACTGACCTGACAGGTGGCGG + Intergenic
1119612186 14:76072942-76072964 CACACAGTTGTGACAGGAGCGGG + Intronic
1119792400 14:77364067-77364089 TACTCTGATGTGCCAGGTGTGGG - Intronic
1119907286 14:78317355-78317377 GCCACTGATCTGACAGGAGGCGG - Intronic
1120065589 14:80037582-80037604 GTCACTGATCTGACAGGAGGGGG - Intergenic
1120633590 14:86923484-86923506 GCCACTGATCTGACAGGAGGTGG - Intergenic
1121648661 14:95539034-95539056 GTCACTGATGTGGCAGGAGGCGG - Intronic
1122074708 14:99228686-99228708 GCCAAAGATGTGGCAGGTGCTGG + Intronic
1122280211 14:100617769-100617791 GAAACTGGAGTGACAGATGCTGG + Intergenic
1122302383 14:100738551-100738573 GACATGAAGGTGACAGGTGCAGG + Intergenic
1122816757 14:104317859-104317881 GACACTAACGTGAGAGGTGAAGG + Intergenic
1123069228 14:105633773-105633795 GCCACTGATCTGACAGGAGGTGG - Intergenic
1123756496 15:23401197-23401219 CACACTGATCTGACAGGAGGCGG + Intergenic
1123965563 15:25453496-25453518 GCCACTGATCTGACAGGAGGCGG - Intergenic
1124138001 15:27051979-27052001 GCCACTGATCTGACAGGAGGCGG + Intronic
1124638866 15:31382620-31382642 CACACTGAGCTGCCAGGTGCAGG - Intronic
1124788446 15:32703707-32703729 GCCACTGATCTGACAGGAGGCGG - Intergenic
1126038000 15:44565467-44565489 GTCACTGATCTGACAGGAGATGG + Intronic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1126425384 15:48522010-48522032 GCCACTGATCTGACAGAGGCAGG - Intronic
1126911525 15:53422084-53422106 GCCACTGATCTGACAGGAGGTGG - Intergenic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1130354884 15:83120185-83120207 GAGTCTGATGTGAAAGGTGCTGG + Intronic
1132157338 15:99504844-99504866 CACACTGCTGTGACGGGTTCTGG - Intergenic
1132196157 15:99916180-99916202 GACACTCATGTGACATGTGGAGG + Intergenic
1132575698 16:662810-662832 GCCACTGATGAGACGTGTGCTGG - Exonic
1134333425 16:13271216-13271238 TACACTGATGTTACAGTTCCCGG - Intergenic
1134661282 16:15986443-15986465 GCCACTGATCTGACAGGAGGTGG - Intronic
1134689224 16:16180097-16180119 GCCACTGATCTGACAGGAGGTGG + Intronic
1134777413 16:16865181-16865203 GACACTGACATGACAAGTGAAGG - Intergenic
1135127641 16:19824343-19824365 GCCACTGATCTGACAGGAGGTGG + Intronic
1135829016 16:25756707-25756729 GAAACAGATGTCACTGGTGCTGG + Intronic
1137305932 16:47199964-47199986 GCCACTGATCTGACAGGAGGTGG + Intronic
1137990972 16:53154699-53154721 GCCGCTGATGTGACAGGAGGCGG + Intronic
1139234998 16:65328612-65328634 GAACCAGATGTGACAGGTTCTGG + Intergenic
1139959815 16:70711049-70711071 GACACTGATGGGACAGGGGCTGG - Intronic
1140418651 16:74797475-74797497 GCCACTGATCTGACAGGAGGAGG + Intergenic
1140598789 16:76449733-76449755 GACACTGATTTTCCAGGTGCTGG - Intronic
1140672615 16:77293825-77293847 GCCACTGATTTGACAGGAGGTGG + Intronic
1141112110 16:81278357-81278379 GCCACCGATGTGCCAGGTGCTGG + Intronic
1141231014 16:82167723-82167745 GCCACTGATCTGACAGGAGGCGG + Intronic
1141899365 16:86980632-86980654 GACACTGTTGTGAAAGCTTCAGG + Intergenic
1141977437 16:87526813-87526835 GACACAGATGTGTCATGTGGAGG + Intergenic
1142543629 17:681866-681888 GACACTGATCTCACAGATGAGGG + Intronic
1143778797 17:9218584-9218606 GACGCTGAAGGGACAGGGGCAGG + Intronic
1143796607 17:9342191-9342213 GCCACTGATCTGACAGGAGGCGG + Intronic
1143859320 17:9876565-9876587 GACCCTCATGTGAGAGGTGGAGG - Intronic
1144584496 17:16479980-16480002 GCCACTGATCTGACAGGAGGCGG - Intronic
1144865340 17:18332021-18332043 GCCACTGATCTGACAGGAGGCGG + Intronic
1144940625 17:18937508-18937530 GCCACTGATCTGACAGGAGGTGG + Intergenic
1146069539 17:29667461-29667483 GCCACTGATCTGACAGGAGGCGG - Intronic
1146741073 17:35284081-35284103 ACCACTGATGTGACAGGCTCTGG - Intergenic
1147230321 17:39012874-39012896 GCCACTGATCTGACAGGAGGCGG + Intergenic
1147310832 17:39595386-39595408 GACAGTGATGAGACAGGAGCTGG - Intergenic
1147898487 17:43768178-43768200 GACACCTATGTGCAAGGTGCTGG + Exonic
1148531557 17:48398229-48398251 GCCACTGATCTGACAGGAGCTGG - Intronic
1149897609 17:60441199-60441221 GCCACTGATCTGACAGGAGGTGG + Intergenic
1150307271 17:64096252-64096274 GCCACTGATCTGACAGGAGGTGG - Intronic
1150322598 17:64228568-64228590 GCTACTGATGTGACAGGAGGTGG + Intronic
1150527838 17:65942153-65942175 AACACTGATCTGACAGGAGGTGG - Intronic
1150799990 17:68273605-68273627 GACACTGATGTGAGAAATACTGG + Intronic
1150902805 17:69300288-69300310 GCCACTGATCTGACAGGAGGTGG + Intronic
1151494109 17:74449434-74449456 GACAAGGATGGGAAAGGTGCTGG - Intronic
1151923829 17:77178750-77178772 GCCACTGATGTGACAGGAGGTGG + Intronic
1152083672 17:78204624-78204646 CACACAGATGTGACAGCTGGAGG - Intronic
1152224070 17:79084648-79084670 GCCACCGATGTGGCAGCTGCCGG - Exonic
1152789323 17:82270256-82270278 GACCCTGCTGTGACAGTTGGAGG - Intronic
1152990421 18:358562-358584 GCCACTGATCTGACAGGAGGCGG + Intronic
1153471059 18:5445776-5445798 GCCACTGATCTGACAGGAGGCGG - Intronic
1153531458 18:6050954-6050976 GAAGCCGATGTGAGAGGTGCTGG + Intronic
1154965266 18:21349589-21349611 GCCACTGATCTGACAGGAGGTGG - Intronic
1155112006 18:22724983-22725005 GCCACTGATCTGACAGGAGGTGG - Intergenic
1155320166 18:24611319-24611341 GCCACTGATCTGACAGGAGGCGG - Intergenic
1155366997 18:25058663-25058685 GCCACTGATCTGACAGGAGGCGG + Intergenic
1155733891 18:29197265-29197287 GCCACTGATCTGACAGGAGATGG + Intergenic
1155991015 18:32279381-32279403 GCCACTGATCTCACAGGAGCTGG - Intronic
1159021794 18:63149342-63149364 GCCACTGATCTGACAGGAGCCGG + Intronic
1159300690 18:66562425-66562447 GCCACTGATCTGACAGGAGGCGG + Intronic
1159573343 18:70145056-70145078 GCCACTGATCTGACAGGAGGTGG - Intronic
1159900028 18:74037243-74037265 GCCACTGATCTGACAGGAGGTGG + Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1161799600 19:6409496-6409518 GACACTGATGTGAGATATTCTGG - Intergenic
1162881927 19:13666321-13666343 GCCACTGATCTGACAGGAGGCGG + Intergenic
1163198736 19:15746384-15746406 GGCACTGAGATGACAGGTGTGGG + Intergenic
1163681554 19:18685067-18685089 GCCACTGATGTGACTGGCTCAGG + Intronic
1163769422 19:19181857-19181879 CACACTCATGTGCCAGGAGCAGG - Intronic
1164629606 19:29753568-29753590 GAAACTGATGACACAGGTGGAGG - Intergenic
1164650422 19:29887184-29887206 GACCCAGATGTGGCAGGTGTGGG - Intergenic
1165054425 19:33165095-33165117 GCCACTGATCTGACAGGAGGTGG + Intronic
925004358 2:429594-429616 GAAAGTGTTGTGCCAGGTGCCGG + Intergenic
925809540 2:7685667-7685689 GACACTGATGTGAGTGGTAATGG - Intergenic
925964163 2:9047899-9047921 GCCACTGATCTGACAGGAGACGG - Intergenic
926286568 2:11493438-11493460 GCCACTGATCTGACAGGAGGTGG + Intergenic
926824470 2:16890296-16890318 GCCACTGATCTGACAGGAGGTGG - Intergenic
926963076 2:18380099-18380121 TCCACTGATGTGACAGGAGGCGG - Intergenic
927507848 2:23626236-23626258 GCCACTGATCTGACAGGAGGCGG + Intronic
927574844 2:24192361-24192383 GGCAGTGAGGTGACAGGTGTTGG - Intronic
927602593 2:24457112-24457134 GACACCCCAGTGACAGGTGCTGG - Intergenic
927977185 2:27347808-27347830 GACACTGATCTGACTGGTCAGGG - Intronic
927998113 2:27500629-27500651 GACACTGATGTTGCTGGTGCAGG - Intronic
928239824 2:29576725-29576747 GCCACTGATCTGACAGGAGGTGG - Intronic
928539444 2:32270510-32270532 GTCACTGATCTGACAGGAGATGG - Intergenic
928711976 2:34017539-34017561 GCCACTGATCTGACAGGAGATGG + Intergenic
930407126 2:50972772-50972794 GCCACTGATCTGACAGGAGGTGG + Intronic
930600995 2:53443018-53443040 GCCACTGATCTGACAGGAGGGGG - Intergenic
931341959 2:61410372-61410394 GCCACTGATCTGACAGGAGGTGG + Intronic
931720376 2:65063009-65063031 GACACTCCTGTCACAGCTGCCGG - Intronic
933230935 2:79806525-79806547 GACAATGAGGGGACAGGTACAGG - Intronic
933652603 2:84861485-84861507 GCCACTGATCTGACAGGAGGAGG + Intronic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
935414263 2:102799189-102799211 GACACTGTAGTGACAGTTGAAGG + Intronic
935423392 2:102894136-102894158 GCCACTGATCTGACAGGAGGCGG - Intergenic
935742193 2:106159498-106159520 CACACTGATGTCCCAGGAGCAGG + Intronic
935975621 2:108575631-108575653 AACACTGATGTTAGAGTTGCAGG + Intronic
937918660 2:127114570-127114592 AATACTGATGGGTCAGGTGCAGG - Intergenic
940349389 2:152664906-152664928 GCCACTGATCTGACAGGAGGTGG - Intronic
941002738 2:160218802-160218824 GTCACTGATCTGACAGGAGGCGG - Intronic
941106716 2:161363082-161363104 GCCACTGATCTGACAGGAGGTGG - Intronic
941471822 2:165897478-165897500 GTCACTGAGGTGAGAGGTGGGGG + Intronic
941488929 2:166119067-166119089 GCCACTGATCTGACAGGAGGCGG + Intronic
941798278 2:169625940-169625962 GTCACTGATCTGACAGGAGGTGG + Intronic
942520093 2:176794683-176794705 CACAGTGATGTGATAGGGGCTGG - Intergenic
944287579 2:197969010-197969032 GCCACTGATCTGACAGGAGGTGG - Intronic
945027431 2:205632434-205632456 GACACTGATCTGACAGGAGGCGG - Intergenic
945337150 2:208605855-208605877 GTCACTGATCTGACAGGAGGTGG + Intronic
946150400 2:217762333-217762355 GCCACTGATCTGACAGGAGGCGG + Intergenic
946706287 2:222461733-222461755 GCCACTGATCTGACAGGAGGTGG + Intronic
947000860 2:225454622-225454644 GCCACTGATCTGACAGGAGGCGG - Intronic
947679335 2:232015768-232015790 GACGATGATGTAACAGGTGCAGG + Intronic
948334449 2:237196363-237196385 GACTCTGGTGTAACAGGAGCAGG + Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948660762 2:239505283-239505305 GACACTGAGGTGTGAGGTGGTGG + Intergenic
948860005 2:240748248-240748270 GACACTCATCTGAGAGGTGGGGG + Intronic
1171339653 20:24417470-24417492 GACTCTGAAGACACAGGTGCGGG + Intergenic
1172155569 20:32821399-32821421 GACACTGAAGTCCCAGGTGGGGG - Intronic
1172385281 20:34529870-34529892 GACACTGTGGAGACAGGAGCAGG + Intronic
1172575523 20:36005369-36005391 GCCACTGATCTGACAGGAGGTGG + Intronic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1173466710 20:43288705-43288727 GCCACTGATCTGACAGGAGGTGG + Intergenic
1174290253 20:49503342-49503364 GCCACTGATCTGACAGGAGGTGG + Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1175395928 20:58661696-58661718 GACTCTGAAGTGCCAGGTACTGG + Intronic
1176945284 21:14972864-14972886 GCCACCGATGTGACAGGAGGCGG + Intronic
1178235759 21:30839281-30839303 GACACTGATGTCACAGAGCCCGG + Intergenic
1178325286 21:31640874-31640896 GCCACTGATTTGACAGGAGGCGG + Intergenic
1178359772 21:31939117-31939139 GACACTGAGGTGACGGGAGGAGG - Intronic
1178555043 21:33582806-33582828 ACCACTGATGTGACAGGAGATGG - Intronic
1183226434 22:36553435-36553457 GCCGCTGATGTGACAGGAGGTGG + Intergenic
1183742672 22:39677503-39677525 GACCCTGATGTGACGGGCTCAGG - Intronic
1185154219 22:49183582-49183604 GTCACTGAGGTGACAAATGCTGG - Intergenic
1185269200 22:49920912-49920934 GACACTGACGCGTCAGGCGCGGG - Intronic
950352079 3:12365153-12365175 GCCACTGATCTGACAGGAGGTGG + Intronic
951207798 3:19942793-19942815 GCCACTGATCTGACAGGAGGGGG + Intronic
951553603 3:23898874-23898896 GCCACTGATGTGACAGGAGGCGG - Intronic
952999405 3:38918382-38918404 ACCACTGATGTGACAGGAGGTGG - Intronic
953653994 3:44833571-44833593 GCCACTGATTTGACAGGAGGCGG + Intronic
954407765 3:50355034-50355056 GACACTGATGCCACAGCTCCTGG - Exonic
955800950 3:62685839-62685861 GCCACTGATCTGACAGGAGGTGG + Intronic
955905558 3:63804069-63804091 GCCACTGATCTGACAGGAGGCGG + Intergenic
956331780 3:68118328-68118350 GCCACTGATCTGACAGGAGGTGG + Intronic
957632339 3:82733161-82733183 GCCACTGATCTGACAGGAGATGG + Intergenic
958263405 3:91408746-91408768 GCCACTGATCTGACAGGAGGTGG + Intergenic
958263424 3:91408849-91408871 GCCACTGATCTGACAGGAGGTGG + Intergenic
958795793 3:98704897-98704919 GAAACTGATTTGACAGGGACAGG - Intergenic
959045029 3:101464449-101464471 GCCACTGACCTGACAGGTGGTGG - Intronic
960207240 3:114917931-114917953 GACACAGATGTGGCTGGTGTTGG - Intronic
960589090 3:119348090-119348112 GCCACTGATCTGACAGGAGGTGG - Intronic
960946632 3:122971276-122971298 GTCTCTTATGTGACTGGTGCTGG - Intronic
961195023 3:124994239-124994261 GCCGCTGATGTGACAGGAGGCGG + Intronic
961222348 3:125211325-125211347 GACCCAGATGTCCCAGGTGCAGG - Exonic
961400180 3:126635080-126635102 GTCACTGCTGGGACAGGTTCGGG - Intronic
962505192 3:136039610-136039632 GCCACTGATCTGACAGGAGGTGG + Intronic
963778991 3:149468114-149468136 AGCACTGATGTGTCAGGTACTGG - Intergenic
964165835 3:153704286-153704308 GCCACTGATCTGACAGGAGGTGG + Intergenic
964744133 3:159996647-159996669 GCCACTGATCTGACAGGAGGCGG - Intergenic
964791731 3:160459672-160459694 GCCACTGATCTGACAGGAGGTGG - Intronic
965398402 3:168188750-168188772 GACAGTGATGGAACAGGAGCGGG - Intergenic
965946048 3:174242506-174242528 GCCACTGATTTGACAGGAGATGG - Intronic
966461538 3:180181882-180181904 GACTCTGATATCAGAGGTGCTGG + Intergenic
968204805 3:196789930-196789952 GCCACTGATCTGACAGGAGGTGG + Intronic
968855765 4:3120567-3120589 GCCACTGATCTGACAGGAGGCGG - Intronic
969697429 4:8742636-8742658 GCCACTGATCTGACAGGAGGTGG + Intergenic
971587151 4:28418548-28418570 GCCACTGATCTGACAGGCGGTGG + Intergenic
971673172 4:29590951-29590973 GCCACTGATCTGACAGGAGGTGG + Intergenic
971673180 4:29591011-29591033 GCCACTGATCTGACAGGAGGAGG + Intergenic
974576873 4:63736955-63736977 GAAACTGATGTGGTAGGTTCAGG + Intergenic
975349791 4:73332240-73332262 GCCACTGATCTGACAGGAGGTGG - Intergenic
975457777 4:74612989-74613011 GATTCTGATGTGACATGTGCAGG + Intergenic
975579468 4:75893605-75893627 GATTCTGATGTTACAGGTCCAGG - Intronic
975834844 4:78411658-78411680 GACACTGATGGGAGATGTGTTGG - Intronic
975858129 4:78646632-78646654 GACACTGATGTGATGGATGTAGG - Intergenic
976111116 4:81674849-81674871 GCCACTGATCTGACAGGAGACGG + Intronic
976511980 4:85921757-85921779 GCCACTGATCTGACAGGAGGAGG - Intronic
976703032 4:87991893-87991915 GCCACTGATCTGACAGGAGGTGG + Intergenic
978471652 4:109074173-109074195 ACCACTGATGTGACAGGAGGTGG + Intronic
978499692 4:109395887-109395909 GCCACTGATCTGACAGGAGGCGG - Intergenic
981734726 4:147936922-147936944 GCCACTGATCTGACAGGAGGCGG - Intronic
982046941 4:151457572-151457594 GACATATATGTGACAGGTGGAGG - Intronic
982763734 4:159319267-159319289 GCCACTGATTTGACAGGAGGTGG - Intronic
985488342 5:164365-164387 GCCACTGATCTGACAGGAGGCGG + Intronic
986367408 5:7046735-7046757 GACACTTATGTGAGAGTTTCAGG + Intergenic
988808130 5:34759459-34759481 GCCACTGATCTGACAGGAGGCGG - Intronic
989736019 5:44707902-44707924 GCCACTGATCTGACAGGAGGCGG - Intergenic
990468893 5:56095157-56095179 GCCACTGATCTGACAGGAGGTGG + Intergenic
991430835 5:66543330-66543352 AACACTGATCTGACAGGAGGTGG - Intergenic
992428848 5:76687635-76687657 GCCACTGATCTGACAGGAGGTGG - Intronic
992485678 5:77192025-77192047 GCCACTGATCTGACAGGAGACGG + Intergenic
993077159 5:83247393-83247415 GCCACTGATCTGACAGGAGGTGG - Intronic
993938886 5:94034860-94034882 GCCACTGATCTGACAGGAGGTGG - Intronic
994938235 5:106284525-106284547 GCCACTGATCTGACAGGGGGTGG + Intergenic
996583187 5:125054388-125054410 GCCACTGATCTGACAGGAGGCGG - Intergenic
996658485 5:125970224-125970246 GACACTGGTGGGACAGCTGATGG + Intergenic
997172421 5:131736585-131736607 GAGGCTGATGTGACAGGAGGTGG - Intronic
998069892 5:139189294-139189316 GCCACTGATCTGACAGGAGGCGG - Intronic
1000993874 5:167939338-167939360 GCCACTGATGTGACAGGAGGCGG + Intronic
1001318004 5:170657949-170657971 GACACAGATGTGATACCTGCTGG + Intronic
1001542887 5:172551475-172551497 GACACTGATGCCGCTGGTGCAGG - Intergenic
1001854657 5:175000452-175000474 GCCACTGATCTGACAGGAGGCGG + Intergenic
1003142835 6:3485880-3485902 GACTCTGATGTGGCAAGTGCAGG - Intergenic
1003231955 6:4262254-4262276 GCCACTGATCTGACAGGAGGCGG - Intergenic
1003828182 6:9975403-9975425 GACACTGATGCTACTGGTCCAGG - Intronic
1004034895 6:11914373-11914395 GCCACTGATCTGACAGGAGGTGG + Intergenic
1004148510 6:13092124-13092146 GCCACTGATCTGACAGGAGACGG + Intronic
1004529239 6:16438136-16438158 GCCACTGATCTGACAGGAGGTGG + Intronic
1006041780 6:31261997-31262019 GCCACTGATCTGACAGGAGGCGG - Intergenic
1006051440 6:31347906-31347928 GCCACTGATCTGACAGGAGGCGG - Intronic
1007244427 6:40450328-40450350 GACTCTGATGGGCCAGGAGCTGG - Intronic
1007344170 6:41215943-41215965 GCCACTGATTTGACAGGAGGCGG + Intergenic
1007775222 6:44221323-44221345 GACAGTCATGAGACATGTGCTGG + Intronic
1008157248 6:48031430-48031452 GACACTATTGTGATAGGTGCAGG - Intronic
1008992012 6:57614127-57614149 GCCACTGATCTGACAGGAGGTGG - Intronic
1009180608 6:60513069-60513091 GCCACTGATCTGACAGGAGGTGG - Intergenic
1009180625 6:60513172-60513194 GCCACTGATCTGACAGGAGGTGG - Intergenic
1009920945 6:70060527-70060549 GCCACTGATCTGACAGGAGGTGG - Intronic
1011139867 6:84141062-84141084 GCCACTGATCTGACAGGAGGCGG + Intronic
1013045219 6:106478778-106478800 GCCACTGATCTGACAGGAGGTGG - Intergenic
1013437723 6:110128821-110128843 GCCACTGATCTGACAGGTGGTGG - Intronic
1013547554 6:111173591-111173613 GCCACTGATCTGACAGGAGGTGG - Intronic
1013632760 6:112001128-112001150 TACACTGATGTGGCAGATGAGGG + Intergenic
1013825487 6:114205862-114205884 GCCACTGATCTGACAGGAGGTGG + Intronic
1014460436 6:121688245-121688267 GCCACTGATCTGACAGGAGGCGG + Intergenic
1015646194 6:135391455-135391477 GTCACTGATCTGACAGGAGGCGG + Intronic
1017093765 6:150785797-150785819 GCCACTGATCTGACAGGAGGTGG - Intronic
1017223048 6:151988369-151988391 GCCACTGATCTGACAGGAGGTGG + Intronic
1017430831 6:154369222-154369244 GCCACTGATCTGACAGGAGGTGG - Intronic
1018104013 6:160466120-160466142 GCCACTGATCTGACAGTTGGTGG + Intergenic
1018270340 6:162070785-162070807 GCCACTGATTTGACAGGAGGTGG + Intronic
1018515399 6:164574172-164574194 GCCACTGATCTGACAGGAGGTGG + Intergenic
1018751977 6:166814575-166814597 GCCACTGACCTGACAGGTGGCGG - Intronic
1019385089 7:750606-750628 GCCACTGATCTGACAGGAGGTGG + Intronic
1019704209 7:2489849-2489871 GAAAATGGTGTGAGAGGTGCTGG + Intergenic
1019866148 7:3712220-3712242 GCCACTGATCTGACAGGAGGTGG - Intronic
1020911801 7:14140452-14140474 GCCACTGATCTGACAGGAGGTGG + Intergenic
1021045776 7:15921518-15921540 GAGACTGAAGTGAGAGGTGTTGG - Intergenic
1021590385 7:22254869-22254891 GCCACTGATCTGACAGGTGGTGG + Intronic
1021695727 7:23274259-23274281 GCCATTGATGTGAGATGTGCTGG + Exonic
1022291055 7:29003889-29003911 GCCACTGATTTGACAGGAGGCGG + Intronic
1022443214 7:30450370-30450392 GACACTGGTGTGACAGGCACTGG + Intronic
1022487595 7:30791561-30791583 CACACTCACCTGACAGGTGCGGG - Exonic
1024157005 7:46636254-46636276 GACACTGACCTGGCAGGGGCTGG + Intergenic
1025108118 7:56190132-56190154 GCCACTGATGTGACAGGAGGTGG + Intergenic
1026053483 7:66965940-66965962 GCCACTGATCTGACAGGGGGTGG + Intergenic
1026149594 7:67776716-67776738 GCCACTGATCTGACAGGAGGTGG + Intergenic
1026292125 7:69017339-69017361 GCCACTGATCTGACAGGAGGTGG + Intergenic
1026326333 7:69314004-69314026 GCCACTGATCTGACAGGAGGTGG + Intergenic
1026344383 7:69461602-69461624 GCCACTGATCTGACAGGAGGTGG - Intergenic
1027398769 7:77786320-77786342 GCCACTGATCTGACAGGAGGTGG + Intergenic
1027426666 7:78068258-78068280 GCCACTGATCTGACAGGAGGTGG + Intronic
1028498300 7:91487765-91487787 AAAACTGATGAGACAGCTGCAGG - Intergenic
1029241645 7:99167374-99167396 GCCACTGATCTGACAGGAGGCGG - Intergenic
1031497236 7:122465494-122465516 GACACTGATCTGACAGGAGGTGG - Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1031799933 7:126230213-126230235 GCCACTGATCTGACAGGAGGTGG + Intergenic
1033059622 7:138093595-138093617 GACACTGTTGTCACAGGAGATGG - Intronic
1035600486 8:894305-894327 GAGACTGGTGTGACAGGGACAGG + Intergenic
1036132734 8:6131580-6131602 AACACTGATCTGACAGGAGGCGG + Intergenic
1037190343 8:16117198-16117220 GCCACTGATCTGACAGGAGGTGG - Intronic
1037617601 8:20533675-20533697 GAAACAGAGGTGACAGGGGCTGG + Intergenic
1037987695 8:23299931-23299953 GACACAGCTGAGCCAGGTGCAGG - Intronic
1038345857 8:26731873-26731895 GCCACTGATCTGACAGGAGGTGG - Intergenic
1038690854 8:29762088-29762110 GACATGGATGGAACAGGTGCAGG + Intergenic
1039375519 8:37028814-37028836 GCCACTGATCTGACAGGAGGTGG - Intergenic
1039618840 8:38978274-38978296 GCCACTGATCTGACAGGAGGTGG - Intronic
1039782272 8:40797245-40797267 CACACTGCTCAGACAGGTGCTGG - Intronic
1040081443 8:43290025-43290047 GACACAGATCTTACACGTGCTGG - Intergenic
1041234095 8:55781525-55781547 GGCACTGAAGTGTCAGGTGGAGG - Intronic
1041281590 8:56215587-56215609 GCCACTGATGTGACAGGAAGGGG + Intronic
1041483147 8:58345306-58345328 GCCACTGATCTGACAGGAGGTGG + Intergenic
1041502734 8:58556323-58556345 GCCACTGATCTGACAGGAGCTGG + Intronic
1041712596 8:60907818-60907840 AACACTGATCTGACAGGAGGTGG - Intergenic
1041823883 8:62069220-62069242 GGCACTGATTTGATAGGGGCAGG - Intergenic
1043113159 8:76213764-76213786 GACACAGATGTGAAAGTTGAGGG - Intergenic
1044860105 8:96514798-96514820 GCCACTGATCTGACAGGAGGCGG + Intronic
1044866382 8:96575029-96575051 GCCACTGATCTGACAGGAGGCGG + Intronic
1045229800 8:100293091-100293113 GCCACTGATCTGACAGGAGGTGG + Intronic
1046162951 8:110390811-110390833 GACACTGCTGTAACAGGAGAAGG - Intergenic
1048258459 8:132924252-132924274 GCCACTGATCTGACAGGAGGCGG + Intronic
1048723771 8:137358551-137358573 GCCGCTGATCTGACAGGAGCTGG - Intergenic
1049302705 8:141880033-141880055 GTCACTGCAGTTACAGGTGCAGG + Intergenic
1050074220 9:1847020-1847042 ACCACTGATCTGACAGGTGGTGG + Intergenic
1050558809 9:6812604-6812626 GCCACTGATCTGACAGGAGGTGG + Intronic
1052463519 9:28798868-28798890 GACACATATGTGAGAGGTACAGG + Intergenic
1053146643 9:35716594-35716616 GACACTGAGGTGTCAGGGGTGGG + Intronic
1057480009 9:95437470-95437492 GAGACTGATATTACAGGTGCAGG + Intergenic
1059164358 9:112064282-112064304 GCCACTGATCTGACAGGAGGTGG - Intronic
1059361828 9:113749500-113749522 ACCACTGATCTGACAGGTGGTGG - Intergenic
1059814127 9:117892555-117892577 GAAGCTGATGTGAAAGGTGGGGG - Intergenic
1061149287 9:128819891-128819913 GCCACTGATCTGACAGGAGGCGG + Exonic
1061467558 9:130793835-130793857 GCCACTGATCTGACAGGAGGCGG - Intronic
1061973832 9:134058501-134058523 GACAGGGATGTAACAGGGGCTGG - Intronic
1062474860 9:136721902-136721924 CACACTGAGGAGACAGGTGCAGG - Exonic
1186111230 X:6258304-6258326 GACACTGAAATTTCAGGTGCAGG - Intergenic
1186341993 X:8655360-8655382 GCCACTGATCTGACAGGAGGCGG + Intronic
1186791883 X:13007677-13007699 CACACTGATGTGACAAATTCAGG + Intergenic
1187542226 X:20208227-20208249 GCCACTGATCTGACAGGAGGTGG + Intronic
1187969709 X:24647342-24647364 GACACTGAAGCGGCTGGTGCGGG + Intronic
1188444922 X:30246355-30246377 GACCTTGATGTGAGAGGAGCAGG + Exonic
1188791521 X:34412855-34412877 GAATCTGAGGTGACAGGGGCTGG + Intergenic
1189114885 X:38332035-38332057 GCCACTGATCTGACAGGGGGTGG - Intronic
1190097286 X:47491881-47491903 GCCACTGATCTGACAGGAGGTGG + Intergenic
1190126647 X:47711526-47711548 AACACAGATGTGAGAGGTTCAGG + Intergenic
1190402172 X:50048243-50048265 GCCACTGATCTGACAGGAGGTGG + Intronic
1192407542 X:70901632-70901654 GCCACTGATCTGACAGGAGGCGG + Intronic
1192478362 X:71463698-71463720 GACACTAAAGTGACTGGTTCTGG - Intronic
1195922366 X:109996282-109996304 GCCACTGATTTGACAGGAGGCGG + Intergenic
1195928423 X:110049516-110049538 GTCACTGATCTGACAGGAGGTGG + Intronic
1196402295 X:115329407-115329429 GCCACTGATCTGACAGGAGGTGG + Intergenic
1196979341 X:121194501-121194523 GCCAATGAGGTGAAAGGTGCGGG + Intergenic
1198045537 X:132898026-132898048 GCCACTGATCTGACAGGAGGCGG - Intronic
1199285826 X:146053268-146053290 GCCACTGATCTGACAGGAGGTGG - Intergenic
1199605808 X:149578882-149578904 GCCACTGACGTGACAGGAGGTGG - Intergenic
1199633313 X:149790486-149790508 GCCACTGACGTGACAGGAGGTGG + Intergenic
1199656211 X:149997820-149997842 GACACTGATGAGAACAGTGCTGG - Intergenic
1200232408 X:154450565-154450587 GTCACTGATGTGGCAGGGGCAGG - Exonic
1201241892 Y:11965425-11965447 GTCACTGATCTGACAGGAGGTGG + Intergenic
1201484897 Y:14483190-14483212 GACACTGAAATTTCAGGTGCAGG + Intergenic