ID: 1031592693

View in Genome Browser
Species Human (GRCh38)
Location 7:123612559-123612581
Sequence CCATGGCTCGCACTGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031592693_1031592700 -5 Left 1031592693 7:123612559-123612581 CCTTAACACAGTGCGAGCCATGG 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1031592700 7:123612577-123612599 CATGGATGGGGATCAGCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 264
1031592693_1031592701 -4 Left 1031592693 7:123612559-123612581 CCTTAACACAGTGCGAGCCATGG 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1031592701 7:123612578-123612600 ATGGATGGGGATCAGCTGGAGGG 0: 1
1: 0
2: 1
3: 21
4: 268
1031592693_1031592698 -8 Left 1031592693 7:123612559-123612581 CCTTAACACAGTGCGAGCCATGG 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1031592698 7:123612574-123612596 AGCCATGGATGGGGATCAGCTGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031592693 Original CRISPR CCATGGCTCGCACTGTGTTA AGG (reversed) Intronic
901897819 1:12329558-12329580 CCAGGGCTGGCACTGTGGGAAGG + Intronic
902042063 1:13499786-13499808 CCGTGGGTCGCACTGTGGTCTGG - Intronic
903440493 1:23384469-23384491 CCATGGCTCCCACTGTCTTTAGG + Intronic
917096858 1:171406959-171406981 CAAGGGCCCGCACTGAGTTAAGG + Intergenic
918250619 1:182699939-182699961 CCAGGGCAGGCACTGTGTGAGGG - Intergenic
920741236 1:208583018-208583040 TCATGGCTCTCTCTGTGTTCTGG - Intergenic
921290475 1:213652233-213652255 ACGTGCCTGGCACTGTGTTAAGG + Intergenic
923140198 1:231155529-231155551 CCATGGCTCTCGCTGTGGTCAGG + Intergenic
924384461 1:243488837-243488859 CCTTGGTACGCACTGTGTGAAGG - Intronic
1068683561 10:59845843-59845865 CCTTGGTTCTCCCTGTGTTAGGG - Intronic
1070446108 10:76504950-76504972 CCATGTATAGCACTCTGTTAAGG + Intronic
1072408688 10:95180255-95180277 CCATGGCTCACACTGTGGGCCGG + Intergenic
1072921910 10:99583838-99583860 CTAGGGCTCTCCCTGTGTTACGG + Intergenic
1073772809 10:106753808-106753830 TCATGGCGCCCACTGTGCTATGG - Intronic
1075686395 10:124367820-124367842 CCATGGCCTGCCCTGTGTCATGG + Intergenic
1076407507 10:130222506-130222528 CCGTGGCTTGTGCTGTGTTAAGG + Intergenic
1080447639 11:32352158-32352180 CCATTGCTCTCACTCTGTAAGGG - Intergenic
1086070820 11:82797158-82797180 CCATGGCTGGCCCTGGGTTCTGG + Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1087730503 11:101773063-101773085 CCATCTGTTGCACTGTGTTAAGG + Intronic
1090153469 11:124410522-124410544 CCATGGCTAGAACTCAGTTATGG - Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092812596 12:12285734-12285756 CCATGGCTAGCAGTTTGTTGTGG + Intergenic
1096069352 12:48766377-48766399 GCATGGCTGGCACTGTGGTACGG + Exonic
1096717853 12:53501722-53501744 TCCTGGCTTGCACTGTGTCAGGG + Intronic
1097820176 12:64120698-64120720 CCAGGGCTTGCCCAGTGTTAGGG - Intronic
1108222434 13:48250015-48250037 CCATGACTCGGATTGTATTATGG + Intronic
1108580094 13:51820741-51820763 CCATGGCCCCCACAGTGTTAAGG - Intergenic
1115017150 14:28631749-28631771 CCATGCTTAGCACTGTTTTAGGG + Intergenic
1117572054 14:57057477-57057499 CCATGGCTCAGACTGTGGCAGGG + Intergenic
1119598399 14:75957527-75957549 CCGTGGATCCCACTGTGGTATGG - Intronic
1121309275 14:92926394-92926416 ACATGGTAAGCACTGTGTTAAGG + Intronic
1122438430 14:101713950-101713972 CCCTGGCTTGCACTATGCTATGG + Intergenic
1124140835 15:27075931-27075953 CCGTGACTCGCACTGTGGAAAGG - Intronic
1124627284 15:31315548-31315570 ACATGCCTGGCACTGTGTCAGGG + Intergenic
1130443639 15:83978758-83978780 CCATTGCTCACACTGGGGTATGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143765174 17:9133081-9133103 CGGTGGCTCGCACTGGGTGAAGG - Intronic
1147169553 17:38609939-38609961 CCAGGGCTCCCCCTGTGGTAGGG + Intergenic
936397832 2:112142436-112142458 CCAGGGCTCACACTGCTTTAAGG - Intronic
937836792 2:126479333-126479355 TCAGGGCTCCCACTGTGATATGG + Intergenic
942079390 2:172385804-172385826 CCATGGCTCTCCCTGAGTGAAGG - Intergenic
1173332768 20:42088853-42088875 CCATGCCTGGCACTGTGGTAAGG - Intronic
1174280417 20:49435048-49435070 CCATGGTGGGCCCTGTGTTAGGG - Intronic
1179308733 21:40178209-40178231 GAGTGGCTCGCAGTGTGTTAAGG + Intronic
1179428899 21:41304764-41304786 CCATGGCTCCCAATGTTTTCAGG - Intronic
1179552229 21:42150649-42150671 CCAGGGCTCCCGCTGTGTTTGGG - Intergenic
950104167 3:10377769-10377791 CCATGGCTCCCACTGTCCTCAGG + Intronic
951862585 3:27270324-27270346 CCATGGCTGGCAATGGGTTCTGG - Intronic
953356401 3:42259901-42259923 CAATGACTCCCACTGTGTTGGGG + Intronic
960511661 3:118556491-118556513 ACATGACTCGCATTGTATTAAGG - Intergenic
961561608 3:127734117-127734139 CCATGGATCCCACAGGGTTAAGG - Intronic
964363148 3:155919683-155919705 CCATGGAACGCACTGCGGTATGG - Intronic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
980184579 4:129446089-129446111 CCATGGGTCACACAGTTTTATGG - Intergenic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985843359 5:2326201-2326223 CCATGTCTGGGACTGTGTTTGGG - Intergenic
990355889 5:54965813-54965835 CCATGGCAACCACTGTGTTATGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
996345248 5:122480456-122480478 CCATGACTGGCATTCTGTTATGG - Intergenic
999285747 5:150393302-150393324 CCATGACTCGGGCTGGGTTATGG + Intronic
1001978893 5:176023973-176023995 CCATGCCTCCCAGTGTGATATGG - Intronic
1002238522 5:177819793-177819815 CCATGCCTCCCAGTGTGATATGG + Intergenic
1002523776 5:179805055-179805077 CCATGGCACCCACTGTGTCTGGG - Intronic
1008427543 6:51377117-51377139 CCATGCCTTCCCCTGTGTTAGGG + Intergenic
1009247575 6:61258550-61258572 CCATGGTTAGCACTCTCTTAAGG + Intergenic
1012253486 6:97006642-97006664 CCATGGTTAGCACTCTTTTAAGG + Intronic
1013050475 6:106529323-106529345 TCATGGCTCCCAGTGTGTCATGG + Intronic
1018212463 6:161495673-161495695 CCATGGCTGGCTCTGTGGTAAGG - Intronic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1026347458 7:69486761-69486783 CCTTGGCTATCACTGGGTTATGG - Intergenic
1026528176 7:71174061-71174083 CCATGCCTGGCACTGTGCCAGGG - Intronic
1031166912 7:118239917-118239939 CCATGGCTCGCAGTGAATTGTGG - Exonic
1031592693 7:123612559-123612581 CCATGGCTCGCACTGTGTTAAGG - Intronic
1034168320 7:149042886-149042908 CCAGGGCTCCCACTGTCTTCTGG - Intergenic
1037388082 8:18364620-18364642 CCAAGACTGGCACAGTGTTAGGG + Intergenic
1045566763 8:103324984-103325006 CAATGGCTGGCACTGTGTGGTGG + Exonic
1051318553 9:15872449-15872471 CCAGTGCTCGAACTGTGTTGTGG + Intronic
1053307135 9:36992683-36992705 CCATGGCTCCCACTGTCTTAAGG + Intronic
1053826017 9:42025345-42025367 CCATCCCTCACACTGAGTTATGG + Intronic
1054604546 9:67162051-67162073 CCATCCCTCACACTGAGTTATGG - Intergenic
1060421528 9:123472796-123472818 CCGTGGCTGGCCCCGTGTTATGG - Intronic
1187358801 X:18604772-18604794 CCTTGGCTCTCACTTTGTCACGG - Exonic
1188829095 X:34874083-34874105 CCATGGCTCTCACTGTGTCTTGG + Intergenic
1189097282 X:38154002-38154024 CCATGGCTCCAACTTTGTAAGGG + Intronic
1192194625 X:69019910-69019932 CCATGGCAGGCACTGTCTCAAGG + Intergenic
1193116400 X:77779686-77779708 CCAGGCATGGCACTGTGTTAGGG - Intronic
1198860302 X:141061820-141061842 CCCTAGCTCCCACTGTGCTACGG + Intergenic
1198902389 X:141525570-141525592 CCCTAGCTCCCACTGTGCTACGG - Intergenic