ID: 1031593544

View in Genome Browser
Species Human (GRCh38)
Location 7:123621950-123621972
Sequence CATCAGGAATGGAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031593544 Original CRISPR CATCAGGAATGGAGGGCAGT GGG (reversed) Intronic
900388348 1:2420716-2420738 CCTCAGGCCTGGAGGGCTGTGGG + Intergenic
900790213 1:4675053-4675075 CATCAGGGCTGGAGAGCGGTGGG + Intronic
901882427 1:12202115-12202137 CACCAGGCGTGGAGGCCAGTGGG + Exonic
902375919 1:16029898-16029920 CCTCAGGGATGGAGGGCTGTGGG + Intronic
902380864 1:16051643-16051665 CCTCAGGGATGGAGGGCTGTGGG + Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
909468593 1:76001647-76001669 CATCTTAAATGGATGGCAGTAGG - Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
912968848 1:114261278-114261300 CATCTGTAAAGGACGGCAGTTGG + Intergenic
912986280 1:114435612-114435634 CAAGAAGAATGGAGGACAGTAGG + Intronic
913288446 1:117249736-117249758 CATCAGGAATGAAAGCCAGTAGG - Intergenic
914510881 1:148330830-148330852 CTTCAGGAAAGAAGGGCAGGGGG - Intergenic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
916229920 1:162531492-162531514 CATCTGGGCTGGAGCGCAGTTGG - Intergenic
916466751 1:165080767-165080789 CATCTGGCATGGATGGCAGTAGG - Intergenic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
918418987 1:184342832-184342854 CAACAGAGATGGAGGGCAGTGGG - Intergenic
918873401 1:190006706-190006728 CAACAAGACTGGTGGGCAGTGGG - Intergenic
919135529 1:193503826-193503848 CATCTTACATGGAGGGCAGTAGG - Intergenic
919173795 1:193992788-193992810 CATCAGGAATGATGGTCTGTCGG - Intergenic
919974704 1:202602982-202603004 AATCAGGTATGCAGGGCTGTGGG - Exonic
920383334 1:205548663-205548685 CACCAGGAATCCAGGCCAGTGGG + Intergenic
921989924 1:221354174-221354196 CATCAGGAAGGCAGGAAAGTAGG - Intergenic
923618261 1:235555906-235555928 CATCCAGACTGGAGTGCAGTAGG + Intronic
923985469 1:239377102-239377124 TATCAGGTAGCGAGGGCAGTGGG + Intergenic
924948528 1:248862672-248862694 TCTCAGGATTTGAGGGCAGTGGG - Intergenic
1064322615 10:14319995-14320017 CATCAGGATTGGATGGGAGATGG - Intronic
1065411332 10:25432326-25432348 CATCAGCAATAGATGGGAGTAGG - Intronic
1067247503 10:44558798-44558820 CAACAGGAATGGGGGGCCTTTGG + Intergenic
1067509205 10:46881502-46881524 CCCCAGGAATGGAGAGCTGTTGG + Intergenic
1067653048 10:48170353-48170375 CCCCAGGAATGGAGAGCTGTTGG - Intronic
1068811770 10:61263655-61263677 CATCTGAAAGGGAGGGCAGTGGG - Intergenic
1070175637 10:73967091-73967113 CTTCAGGTATGGAGGGTATTAGG + Intergenic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1071563299 10:86659107-86659129 TAGCAGGAATGGGAGGCAGTGGG + Intronic
1071908524 10:90203020-90203042 CATCAGGGATGGAGAGAAGCAGG - Intergenic
1073637065 10:105210088-105210110 CAACAGGAATGAAGGGGAGAGGG - Intronic
1075346063 10:121682689-121682711 CCTTAGGAATGGATGGCAGAGGG - Intergenic
1075552102 10:123400359-123400381 CATCTGGAATGAAGTGCAGGGGG - Intergenic
1075761021 10:124856768-124856790 CCTCAGGAAGGGAGGGGAGAGGG - Intergenic
1078428638 11:11270574-11270596 CCTCAGGAATGAAGGGCTGCAGG + Intergenic
1078893737 11:15579949-15579971 CATGAGCAAGAGAGGGCAGTTGG + Intergenic
1079387649 11:19995051-19995073 GATAAGGAAAGGAGTGCAGTAGG + Intronic
1081729341 11:45358156-45358178 CATTTGGGATGGAGGGCAGAGGG + Intergenic
1083854381 11:65385465-65385487 GATCAGGAACAGAGGGCAGTGGG - Intergenic
1083947408 11:65931950-65931972 GAACAGGGAGGGAGGGCAGTGGG + Intergenic
1085405581 11:76259882-76259904 CATAAGGAGTTGAGGGCAGCAGG + Intergenic
1085819725 11:79779585-79779607 CCTCAGGAGTAGAGGGCAGTTGG + Intergenic
1087090425 11:94265439-94265461 CATCAGGAATGCTGGCCTGTAGG + Intergenic
1088170192 11:106987610-106987632 CACCCAGAATGGAGTGCAGTGGG - Intronic
1088865138 11:113840178-113840200 CTACAGGATTGGTGGGCAGTTGG - Intronic
1088865699 11:113845612-113845634 CACCAGGGCTAGAGGGCAGTAGG + Intronic
1088920798 11:114258518-114258540 CACCAGGAAGGGAGGGGATTGGG + Intronic
1089695466 11:120213478-120213500 CATCAGCAAGGGAGGGAATTGGG + Intronic
1091357936 11:134952325-134952347 CCACAGGAAAGGAGGTCAGTGGG - Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091890645 12:4051549-4051571 CATGAGAAATGGAGGGCAATAGG - Intergenic
1091959448 12:4679917-4679939 CTTCAGGAATTGAGAGGAGTTGG + Intronic
1094412012 12:30176628-30176650 TATCAGGAAGGGAGGCCACTGGG + Intergenic
1095729360 12:45489835-45489857 CATCCAGGATGGAGTGCAGTGGG + Intergenic
1096562689 12:52447968-52447990 CATCAGCAATGGCGGCCTGTAGG + Exonic
1099932269 12:89088137-89088159 CATTCAGAAAGGAGGGCAGTGGG + Intergenic
1099957849 12:89368643-89368665 CATCAGGTGGGGAGGGCAGTGGG + Intergenic
1100212882 12:92416467-92416489 CTTCAGGAATGTTGGGCCGTTGG - Intergenic
1100516155 12:95329813-95329835 CACCCAGACTGGAGGGCAGTGGG - Intergenic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1102803584 12:115759378-115759400 CATCAGGAATGGAAAGAAGTGGG - Intergenic
1106052662 13:26206199-26206221 CAGCAGGGACGGGGGGCAGTGGG - Intronic
1106906545 13:34415514-34415536 ATTCAGGGATTGAGGGCAGTTGG + Intergenic
1107850540 13:44568276-44568298 AGTCAAGAATGGAGGTCAGTGGG + Intronic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1112296873 13:98195573-98195595 CACAAGGAAGGGAGGGCAGTGGG + Intronic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114452487 14:22836498-22836520 AACCAGGAAAGGAGGGCACTGGG + Intergenic
1114614899 14:24063058-24063080 CATGAGGAATGGATGGCTCTGGG + Intronic
1114650682 14:24282717-24282739 CATGAGGAATGCTGGGAAGTAGG - Intergenic
1117502456 14:56367092-56367114 CATCAGGAATGGGGAGCTTTTGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122072597 14:99214206-99214228 AATCTGGAGTGGAGGGCAGTAGG - Intronic
1122970501 14:105150291-105150313 CCTCGGGACTGGAGGGCAGGGGG - Intronic
1123050010 14:105536788-105536810 CACCAGGAATGGCGTGGAGTAGG + Intergenic
1123811427 15:23930177-23930199 CATGGGGAATGGAGGTCAGTGGG + Intergenic
1125410002 15:39396151-39396173 CCTCAGAGATGGAGGGCACTTGG - Intergenic
1127771704 15:62236677-62236699 ACTCAGCAATGGAGGGCAGAAGG - Intergenic
1128990040 15:72252098-72252120 GATCAGGAATGGATGGCAGCAGG + Intronic
1129172820 15:73818248-73818270 CACCAGGAAGGGAGGCCAGCTGG - Intergenic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133122533 16:3619073-3619095 CATCCAGAATGGAGTGCAGTGGG + Intronic
1133419649 16:5635403-5635425 CATGAGGAATGGAGGCCACCAGG - Intergenic
1135583195 16:23645561-23645583 TATCAGCAATGGAAGGAAGTAGG - Intronic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1137500837 16:49010690-49010712 ACTCAGGAACGGAGGGCAGCAGG - Intergenic
1137806603 16:51312364-51312386 CATCTGGCAGGAAGGGCAGTTGG - Intergenic
1138389869 16:56662605-56662627 CCTCAGAAATGGAAGGCACTGGG + Intronic
1139346472 16:66306977-66306999 GAAAAGGCATGGAGGGCAGTGGG - Intergenic
1139476254 16:67203915-67203937 CAGCAGCCATGAAGGGCAGTGGG + Exonic
1140270025 16:73457289-73457311 CATCAGGAATGGAGACCATGAGG + Intergenic
1141319406 16:82993236-82993258 CATCTGGAAAGGAGGGAACTTGG - Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142062489 16:88039689-88039711 CAGCAGGCATGGAGGCCCGTTGG + Intronic
1142120524 16:88384372-88384394 TTTCAGGAATGCAGGGCTGTGGG - Intergenic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1144189333 17:12829803-12829825 GATCATGAATGTGGGGCAGTAGG - Intronic
1144678282 17:17175659-17175681 TAGCAGAAATGGAGGGGAGTGGG - Intronic
1145796508 17:27658678-27658700 GATCAGGGCTGGTGGGCAGTGGG - Intergenic
1145810943 17:27763953-27763975 GATCAGGGCTGGTGGGCAGTGGG - Intronic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1148070134 17:44903918-44903940 CATCAGGAAAGCAGGGCAGGGGG - Exonic
1149026732 17:52035781-52035803 CATGAGGAGTTGAGGGCGGTGGG + Intronic
1149565883 17:57640127-57640149 CATCAGGGCAGGAGGGCACTGGG + Intronic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1151809567 17:76430061-76430083 CATCAGGAATTGGAGGCAATTGG - Intronic
1152995861 18:405907-405929 CGTCAGGAATGCAGCCCAGTAGG - Intronic
1153010010 18:529896-529918 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1153736434 18:8073862-8073884 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1153997110 18:10452805-10452827 CTTCACGAATGTTGGGCAGTTGG - Intergenic
1154143510 18:11846764-11846786 CACCCCGAATGGAGTGCAGTGGG + Intronic
1154207486 18:12350050-12350072 CATCTGGGCTGGAGTGCAGTGGG + Intronic
1156387654 18:36620439-36620461 CATCAGCTATGAATGGCAGTAGG - Intronic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1159008851 18:63039592-63039614 CATCCAGGCTGGAGGGCAGTGGG + Intergenic
1161003728 19:1924316-1924338 CAGCAGGAATGAAGGGGAGGAGG - Exonic
1161777906 19:6273832-6273854 CATCAGAAATGCCGGGAAGTCGG - Intronic
1162030067 19:7913446-7913468 AGTCAGGGATGGAGGGCAGAGGG + Exonic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1164684526 19:30158127-30158149 CATGGGGAATGGGGGGCAGCAGG + Intergenic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166328328 19:42064903-42064925 CCCCAGGCATGGAGGGCAGGAGG - Intronic
1166901913 19:46071020-46071042 CATCATGAATGGAGGACCGCAGG - Intronic
1167560230 19:50222625-50222647 CGCCAGGCATGGAGGGGAGTGGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
924995799 2:359311-359333 GATAAGGAGTGCAGGGCAGTGGG - Intergenic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
932030408 2:68177865-68177887 CATCTGGGCTGGAGTGCAGTGGG - Intronic
932750298 2:74367293-74367315 GATCAGAAATGGAGGGCATCAGG - Intronic
933307806 2:80623695-80623717 AATCAGGAATGGTAGGGAGTAGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933767760 2:85721956-85721978 CTTCAGGAATGGATGGCTCTTGG + Intergenic
934971237 2:98766194-98766216 GATGAGGAAGGGAGGACAGTGGG + Intergenic
935092150 2:99905429-99905451 CAAGAGGAAGGGAGGGCAGAGGG - Intronic
935130989 2:100260871-100260893 CCTCAGGAATGGAGGGACTTCGG - Intergenic
937213501 2:120294475-120294497 CATCAGGAAAGGAGCACTGTGGG + Exonic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937723824 2:125135439-125135461 TCTCAGGAGTGGGGGGCAGTGGG + Intergenic
938779862 2:134575338-134575360 CAGCAGGAATGGTGGGCACTGGG - Intronic
941006751 2:160255602-160255624 CTTCAAGAATGCAGAGCAGTGGG - Intronic
941213169 2:162668707-162668729 TATCATGAATGAAAGGCAGTAGG + Intronic
941823242 2:169864084-169864106 CATCCAGAATGGAGTGCAGTGGG + Intronic
943446594 2:187994656-187994678 CATGTGGAATGGAGGGTAGCAGG - Intergenic
944102798 2:196046678-196046700 CATCTTGAAGGGAGGACAGTGGG - Intronic
947274910 2:228379654-228379676 CAGCAGGTATAGAGTGCAGTGGG + Intergenic
948043422 2:234923374-234923396 CATCACAAAATGAGGGCAGTGGG + Intergenic
948211275 2:236195055-236195077 CATCTGGAAGGGAAGGCAGGTGG + Exonic
948610604 2:239163972-239163994 CAGCAGCAATGCAGGGCAGCGGG + Intronic
1168798523 20:628643-628665 CATCAGGGATGGAGGGGACTGGG - Intergenic
1171177259 20:23061715-23061737 CTGCAGGAAAGAAGGGCAGTGGG + Intergenic
1171238738 20:23548314-23548336 GACCAGGGAGGGAGGGCAGTGGG + Intergenic
1171918749 20:31081007-31081029 CATAAGTAATGGAGTGCAATAGG + Intergenic
1171927239 20:31199110-31199132 CATAAGTAATGGAGTGCAATAGG + Intergenic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172400243 20:34644517-34644539 CATCAGGCATGCAAAGCAGTGGG - Intronic
1172683692 20:36737265-36737287 CTTCAGGAGTGGAAGGCAGGGGG - Intronic
1173014958 20:39216436-39216458 GAACAGGAATGGATGACAGTAGG - Intergenic
1173117244 20:40256841-40256863 CAGCAGAAATGGATAGCAGTAGG + Intergenic
1173465039 20:43274093-43274115 CATAGGGAATGGATGGCTGTGGG + Intergenic
1174421418 20:50401417-50401439 CTTCAGGAATCGAGGGGAGGAGG - Intergenic
1174893990 20:54429359-54429381 CATGAGACTTGGAGGGCAGTAGG - Intergenic
1176959874 21:15147214-15147236 CATCATGAACTGATGGCAGTAGG + Intergenic
1177435358 21:21045206-21045228 CATCAGGAGTGGACTGGAGTGGG - Intronic
1179193788 21:39145666-39145688 GAGAAGGAAAGGAGGGCAGTAGG + Intergenic
1180194367 21:46184078-46184100 CATCAGGGAGTGAGGTCAGTAGG - Intronic
1181438884 22:22925505-22925527 GACCAGGAATGGAGGGGATTGGG - Intergenic
1181495449 22:23284977-23284999 CATCAGCCATAGAAGGCAGTCGG + Intronic
1182813600 22:33138482-33138504 CATCCAGGCTGGAGGGCAGTGGG + Intergenic
1183358042 22:37369844-37369866 CACCAGGAAAAGAGGGCAGGGGG - Exonic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
1184281751 22:43441398-43441420 CAGGAGGAAGGGAGGCCAGTAGG - Intronic
1184660910 22:45965112-45965134 CATCAGGAGTGGGGAGCAGCAGG - Intronic
1185224654 22:49645563-49645585 AATGAGGGATGGAGGACAGTTGG + Intronic
950703590 3:14766727-14766749 CACCAGGCAGGGAGGGCAGTTGG + Intronic
950933312 3:16812514-16812536 CAGCAGGAATGGAGGTGGGTAGG + Intronic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
952623406 3:35373806-35373828 TATCAGGAATTGAGGGCATTGGG - Intergenic
953471053 3:43166909-43166931 CATCAGAAATGAAGGTCAGAAGG + Intergenic
953907066 3:46873732-46873754 GCTCAGGAAAGGAGTGCAGTGGG + Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954606910 3:51918657-51918679 AATCAGGAATGGAGAACAGAAGG + Intergenic
956511050 3:69993826-69993848 CAACAGGTAAGGAGGGCACTGGG + Intergenic
957074104 3:75588010-75588032 GCTCAGGAATGGAGGGCTGCAGG - Intergenic
957266721 3:77976259-77976281 CATCAGGAATGAAGGCAAGTGGG - Intergenic
957503672 3:81091839-81091861 CACCAGGAATGCTGTGCAGTGGG + Intergenic
958949534 3:100401317-100401339 CTTCAGGAAAGAAGGGCAGATGG + Exonic
959115255 3:102169977-102169999 CCACAGGAATGGAGAGTAGTGGG - Intronic
960139708 3:114140211-114140233 AATCTGGGATGGAGGGCAGATGG + Intronic
960722314 3:120636771-120636793 CATCAGGAATGAAGGCCCTTAGG - Intronic
961185601 3:124912438-124912460 CAAGAGGCATGGAGGGTAGTGGG + Intronic
961313507 3:126018702-126018724 TCACAGGATTGGAGGGCAGTGGG - Intronic
961477346 3:127157141-127157163 AATCAGGAATTGAGGGCAAGGGG - Intergenic
961738758 3:129018978-129019000 CATCTGGAGTGGCAGGCAGTTGG - Intronic
963969175 3:151410292-151410314 AATCAGGAATGCAGGGGTGTTGG + Intronic
964108088 3:153060401-153060423 TATCAGGAAGGGAGGGAAGGAGG + Intergenic
967268182 3:187710177-187710199 AATCAGGAGTTGAGGGCAGGAGG - Intronic
968774631 4:2533224-2533246 CATCCAGATTGGAGTGCAGTGGG + Intronic
968962623 4:3753172-3753194 CCTCAGGAATGGCTGGCAGGTGG - Intergenic
969239030 4:5887731-5887753 CATCAGTAAAGGCGGGGAGTGGG + Intronic
969355170 4:6620870-6620892 CATGAGGAATTGAGGCCACTAGG + Intronic
970691965 4:18630677-18630699 GCTCAGGCATGGAGGGCAGCAGG + Intergenic
971289854 4:25327518-25327540 CACCCAGATTGGAGGGCAGTGGG + Intronic
972424609 4:38920585-38920607 CATCTGGAAGGGAGAGCATTGGG - Intronic
974868163 4:67605239-67605261 AATCAGGAAAGGTGGGCAGAGGG - Intronic
975128048 4:70804035-70804057 CATCAAGAATGGAAAGCACTGGG - Intronic
975800588 4:78056625-78056647 CAGCAGGAGTGGCGGGCTGTGGG + Intergenic
977571394 4:98633008-98633030 CAGCAGGAAGCCAGGGCAGTTGG + Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
979629011 4:122879730-122879752 CATCTTAAATGGATGGCAGTAGG + Intronic
980740695 4:136946660-136946682 GCTCAGGAAGGGAGGCCAGTGGG + Intergenic
980794094 4:137658781-137658803 CATTAGAAAACGAGGGCAGTTGG + Intergenic
983749140 4:171242657-171242679 CATCAGGAATTTAGGGCAGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
989106824 5:37870646-37870668 CCTCAGTAATGCAGGCCAGTTGG + Intergenic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
990687502 5:58322693-58322715 AAACAGGAAAGGAGGGCAGAAGG + Intergenic
993835438 5:92814132-92814154 CATGAGGCATGGAGGCCATTTGG - Intergenic
995190596 5:109315708-109315730 CATCAGGAATGGAGGGACTCAGG + Intergenic
995253486 5:110019554-110019576 CATAAGGAAAAGAGGTCAGTGGG + Intergenic
995424040 5:111999511-111999533 CATAAGGAATTTAGGGCAGGAGG + Intergenic
995852399 5:116559800-116559822 CAACAGGATTTGAGGCCAGTTGG - Intronic
999663427 5:153889158-153889180 TAACAGGAAAGGAGGGCAGGGGG + Intergenic
1000009705 5:157219748-157219770 CGTCTGCAAGGGAGGGCAGTAGG - Intronic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1003744709 6:8987528-8987550 CACCAGGAATGGAGCCCAGTTGG - Intergenic
1004279063 6:14265087-14265109 CCTCAGGGAAGAAGGGCAGTGGG + Intergenic
1005000916 6:21240735-21240757 TATCAGGAACTGAGGGGAGTGGG + Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1008488824 6:52064266-52064288 AGTCAGGGATGAAGGGCAGTTGG - Intronic
1010116449 6:72317097-72317119 CTTCAGGCATGGGGAGCAGTGGG - Intronic
1012060274 6:94469567-94469589 CATCAGGATTGAAGGGCAACAGG - Intergenic
1012274505 6:97256602-97256624 CAACAACAATGGAGGCCAGTGGG - Intronic
1012274648 6:97258121-97258143 CAACAGCAATGGAGGCCAGTGGG + Intronic
1012380481 6:98614743-98614765 CATCTTAAATGGAGGGCAGCAGG + Intergenic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1016426477 6:143941483-143941505 CATGAGGGATGGGGGGCAGGGGG + Exonic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1018967529 6:168500244-168500266 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1019186728 6:170224787-170224809 GACCAGGAATGCAGGGCAGAGGG - Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1020587410 7:10086300-10086322 CTTCAGGAAGGAAGGGCAGTGGG - Intergenic
1021234882 7:18130651-18130673 CATCGGGAATGGAGGGATTTAGG - Intronic
1022172666 7:27844760-27844782 CAGCTGGCATGCAGGGCAGTGGG - Intronic
1023310396 7:38880575-38880597 CATCAGGGAGGGATGGGAGTGGG - Intronic
1024007187 7:45233625-45233647 CATCAGGAATTGAGGGAGGGAGG - Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028270927 7:88788180-88788202 CATGAGGACTGGAGGCCAGGTGG + Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1029403939 7:100362057-100362079 GAGCAGGAATGGAGAGCAGGGGG + Intronic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029723697 7:102387959-102387981 CATCCAGGCTGGAGGGCAGTGGG - Intronic
1031057439 7:117008643-117008665 CATCAGAAATGAAGGGAATTGGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1033842626 7:145393403-145393425 CATCCAGACTGGAGTGCAGTGGG - Intergenic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038203377 8:25438595-25438617 CTTGAGGAATGGTAGGCAGTTGG - Intronic
1038303287 8:26375974-26375996 CACCCAGACTGGAGGGCAGTAGG + Intergenic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1040709375 8:50169906-50169928 CATCAAGACTAGAGTGCAGTGGG - Intronic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041494700 8:58472465-58472487 CATTAGGCATTGTGGGCAGTTGG + Intergenic
1042640343 8:70927336-70927358 AGTCAGAAATGCAGGGCAGTGGG + Intergenic
1043701039 8:83290125-83290147 CATGAGAAATGGAAGGCAGCAGG - Intergenic
1044208725 8:89523501-89523523 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1049444759 8:142624832-142624854 CCTCAGGCAGGGAGGGCAGGAGG - Intergenic
1051038413 9:12776539-12776561 CACCAAGAAGGGAGGGCAGGAGG - Intronic
1051431207 9:16982851-16982873 CATCAGACATGGAGTTCAGTAGG - Intergenic
1051797467 9:20888810-20888832 CATCTTAAATGGATGGCAGTAGG - Intronic
1051854847 9:21552398-21552420 CATCAGGGATAGAAAGCAGTGGG + Intergenic
1052040654 9:23735315-23735337 CATCCAGACTGGATGGCAGTGGG + Intronic
1053004772 9:34597169-34597191 CATGAGGAATGGTGGGTAGGTGG - Intergenic
1053070771 9:35100621-35100643 CGCCAGGGTTGGAGGGCAGTAGG + Exonic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1056782619 9:89562444-89562466 CATCAGGAAGGGAGGGCGCCAGG - Intergenic
1056947162 9:91007905-91007927 AATCAGAAATGGAGGTCAGGAGG + Intergenic
1057976268 9:99609185-99609207 CATCAGGATTTGAAGTCAGTTGG - Intergenic
1060505169 9:124192167-124192189 CATCAGGGAAGTAGGGAAGTGGG + Intergenic
1060536576 9:124393998-124394020 CCGCAGGAACGCAGGGCAGTGGG + Intronic
1185668504 X:1787493-1787515 CACCAGCAATGGTGGTCAGTGGG - Intergenic
1186667736 X:11735554-11735576 CACCAGAAATGGAGGACTGTGGG + Intergenic
1187555941 X:20351239-20351261 CATCAGGATTCCAGGGCAGAGGG - Intergenic
1189174450 X:38941186-38941208 CTTCAGCATTGGAGGTCAGTAGG - Intergenic
1190595808 X:52052011-52052033 CATGGGAAATGGAGGGCAGCTGG + Exonic
1190613016 X:52202062-52202084 CATGGGAAATGGAGGGCAGCTGG - Exonic
1191141560 X:57120977-57120999 GCTCAGGGAAGGAGGGCAGTGGG - Intronic
1195406955 X:104525003-104525025 CATCAGGAAGGCAGGGAATTGGG + Intergenic
1195673876 X:107491971-107491993 CATCAGCAAGGGATGTCAGTGGG - Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197543071 X:127789890-127789912 CATCAGGAATGGAACATAGTTGG + Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1198310366 X:135423000-135423022 CCTGAGGAATGGAGGGTAATGGG + Intergenic
1198388250 X:136148040-136148062 CACCAAGGATGGCGGGCAGTGGG + Intronic
1199309040 X:146301158-146301180 CATCAGGAATGGTGCTCAGTGGG + Intergenic
1201388163 Y:13466171-13466193 AATCAGGAAGGGAGAGCACTGGG + Intronic