ID: 1031597236

View in Genome Browser
Species Human (GRCh38)
Location 7:123662414-123662436
Sequence GTCCAACTTCATAACGGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031597232_1031597236 29 Left 1031597232 7:123662362-123662384 CCATTGCAGAGATGCTCAAAGTC 0: 1
1: 0
2: 1
3: 14
4: 207
Right 1031597236 7:123662414-123662436 GTCCAACTTCATAACGGGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1031597233_1031597236 -7 Left 1031597233 7:123662398-123662420 CCAACGTAAACGTCGAGTCCAAC 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1031597236 7:123662414-123662436 GTCCAACTTCATAACGGGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031597236 Original CRISPR GTCCAACTTCATAACGGGAA AGG Exonic
902668792 1:17957736-17957758 CTCCAACTTCAGAGCTGGAAGGG - Intergenic
909542483 1:76806521-76806543 TTGCAACTTCATAACAAGAATGG - Intergenic
911229308 1:95343828-95343850 TTCAAATTTCATAAGGGGAAGGG - Intergenic
916052647 1:161047262-161047284 GTCCAAGAACATAACAGGAATGG + Exonic
1073411670 10:103347444-103347466 GTCCAACCTAATAAAAGGAAAGG + Exonic
1074290262 10:112132976-112132998 GTCCAACTGCATGACTGTAAAGG - Intergenic
1078885497 11:15495925-15495947 GTCCACCTTCATGCCGGGAGAGG + Intergenic
1091023568 11:132122634-132122656 GTGCCACCTCATAAAGGGAAGGG + Intronic
1099645889 12:85355767-85355789 GTTCAAGTTCATAACGGAGAGGG + Intergenic
1108277928 13:48829994-48830016 TTCCAATTTCATAATTGGAAGGG - Intergenic
1139296009 16:65901432-65901454 GTCCCACTTGAAAACAGGAAAGG - Intergenic
1150975679 17:70083955-70083977 CTCCAACTTCATAACAGGGGTGG + Intronic
1160815273 19:1032570-1032592 GTCCAACTTCATCAAGGCCATGG + Exonic
1162207165 19:9064749-9064771 GTCCCACTTCATAAAAGCAAAGG + Intergenic
1162892283 19:13742532-13742554 GTGAAACTTCAGAACGTGAAAGG + Intronic
1166601090 19:44095010-44095032 GTCCACTTTCATGAAGGGAAAGG + Intronic
931099030 2:58974328-58974350 GTCCAACTTTAAAAGGGAAATGG + Intergenic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
947661633 2:231873854-231873876 ATACCACTTCACAACGGGAATGG + Intergenic
1171107769 20:22451569-22451591 GTCCAACTTTACAATGGAAATGG + Intergenic
1172599351 20:36173300-36173322 GTCCAGCTTCAGCACTGGAAAGG + Intronic
1178011053 21:28287686-28287708 GTCTAACTTCATGCCTGGAATGG + Intergenic
1179422427 21:41247538-41247560 TTCCAACTTCATATCCTGAATGG + Intronic
1179784940 21:43724214-43724236 GTCCACCTGCCTAACGGGCATGG - Intronic
1182086753 22:27566245-27566267 CTCCAACTTCATAGAGGAAAGGG - Intergenic
949313990 3:2731299-2731321 ACCCATCTTCATAAAGGGAAGGG - Intronic
952815883 3:37447526-37447548 GTCCAATTTCCCAACGGAAATGG - Intergenic
957926829 3:86825159-86825181 CTCTAACTTCATTACAGGAATGG - Intergenic
967666325 3:192176565-192176587 GTCCAAGTTCATACAGGTAAAGG - Intronic
970721481 4:18994492-18994514 GTGCTACTTCATAACAAGAATGG - Intergenic
989768363 5:45113192-45113214 GTCCAACATCATAAAATGAAGGG + Intergenic
993088009 5:83387862-83387884 TTCAAACCTCATAACAGGAATGG - Intergenic
995974818 5:118021367-118021389 GTCCAGCTTCCTAATGTGAAAGG + Intergenic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1018968757 6:168510010-168510032 GTTGAAATTCACAACGGGAAAGG - Exonic
1021460429 7:20880642-20880664 GTTGAACTTCATAAAGGGAAGGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1031597236 7:123662414-123662436 GTCCAACTTCATAACGGGAAAGG + Exonic
1035864588 8:3069029-3069051 TTCCAAGTTCATAAATGGAAGGG - Intronic
1038074397 8:24055310-24055332 GTAGAACTTCATAATGGGGAAGG + Intergenic
1049799478 8:144511118-144511140 GTCCAGGTACAGAACGGGAAAGG - Exonic
1057937982 9:99256802-99256824 GTCCAAACACATAAGGGGAACGG - Intergenic
1059330978 9:113535674-113535696 GTCCAACTGCAAAATGAGAAAGG + Intronic
1190454898 X:50617875-50617897 GACCAACTCCAGAAGGGGAAGGG + Intronic
1194192392 X:90853914-90853936 GTCCCAGTTCATAGAGGGAATGG + Intergenic
1195230595 X:102842937-102842959 TTACAACTTCATAACTTGAATGG - Intergenic
1200273984 X:154714616-154714638 CTCCAACTTCATGCCGGGACAGG + Intronic
1200539030 Y:4436364-4436386 GTCCCAGTTCATAGAGGGAATGG + Intergenic
1201983993 Y:19942379-19942401 GTCCATCAACATAACTGGAAAGG - Intergenic