ID: 1031598059

View in Genome Browser
Species Human (GRCh38)
Location 7:123670513-123670535
Sequence GAGCTAGAGCTGCCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031598059_1031598063 -1 Left 1031598059 7:123670513-123670535 CCTCCCAAAGGCAGCTCTAGCTC No data
Right 1031598063 7:123670535-123670557 CTACCGCTGCATACCCAAATGGG No data
1031598059_1031598062 -2 Left 1031598059 7:123670513-123670535 CCTCCCAAAGGCAGCTCTAGCTC No data
Right 1031598062 7:123670534-123670556 TCTACCGCTGCATACCCAAATGG No data
1031598059_1031598067 16 Left 1031598059 7:123670513-123670535 CCTCCCAAAGGCAGCTCTAGCTC No data
Right 1031598067 7:123670552-123670574 AATGGGTCAATATGACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031598059 Original CRISPR GAGCTAGAGCTGCCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr