ID: 1031609903

View in Genome Browser
Species Human (GRCh38)
Location 7:123813426-123813448
Sequence ATACAATCCAGTTTCTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031609900_1031609903 17 Left 1031609900 7:123813386-123813408 CCTAAAGAGACAAGTTTTATTTA No data
Right 1031609903 7:123813426-123813448 ATACAATCCAGTTTCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031609903 Original CRISPR ATACAATCCAGTTTCTTTAT AGG Intergenic
No off target data available for this crispr