ID: 1031613125

View in Genome Browser
Species Human (GRCh38)
Location 7:123850380-123850402
Sequence CACAGGAACGCACCACCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031613121_1031613125 -4 Left 1031613121 7:123850361-123850383 CCTCCTGAGTATCTGGAACCACA 0: 3
1: 440
2: 8567
3: 65340
4: 188193
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data
1031613116_1031613125 25 Left 1031613116 7:123850332-123850354 CCTGGGCTCAGATGATCCTCCCA 0: 122
1: 2670
2: 14911
3: 39225
4: 98379
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data
1031613119_1031613125 5 Left 1031613119 7:123850352-123850374 CCACTTCAGCCTCCTGAGTATCT 0: 23
1: 1738
2: 17174
3: 31543
4: 43272
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data
1031613123_1031613125 -7 Left 1031613123 7:123850364-123850386 CCTGAGTATCTGGAACCACAGGA 0: 1
1: 20
2: 971
3: 17614
4: 145307
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data
1031613118_1031613125 6 Left 1031613118 7:123850351-123850373 CCCACTTCAGCCTCCTGAGTATC 0: 24
1: 1759
2: 21663
3: 122966
4: 216472
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data
1031613117_1031613125 9 Left 1031613117 7:123850348-123850370 CCTCCCACTTCAGCCTCCTGAGT 0: 900
1: 10502
2: 21833
3: 38850
4: 48895
Right 1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031613125 Original CRISPR CACAGGAACGCACCACCAGC CGG Intronic
No off target data available for this crispr