ID: 1031618574

View in Genome Browser
Species Human (GRCh38)
Location 7:123908916-123908938
Sequence AAGAAGAAGAAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7563
Summary {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031618572_1031618574 8 Left 1031618572 7:123908885-123908907 CCTGGGCAACAGAGTGAGACTGT 0: 988
1: 10645
2: 41908
3: 101046
4: 181313
Right 1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG 0: 12
1: 84
2: 343
3: 1478
4: 5646
1031618571_1031618574 22 Left 1031618571 7:123908871-123908893 CCACTGCACTCTGGCCTGGGCAA 0: 414
1: 5963
2: 81323
3: 190415
4: 230730
Right 1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG 0: 12
1: 84
2: 343
3: 1478
4: 5646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031618574 Original CRISPR AAGAAGAAGAAGAAGGAAGA AGG Intergenic
Too many off-targets to display for this crispr