ID: 1031618574 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:123908916-123908938 |
| Sequence | AAGAAGAAGAAGAAGGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7563 | |||
| Summary | {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031618572_1031618574 | 8 | Left | 1031618572 | 7:123908885-123908907 | CCTGGGCAACAGAGTGAGACTGT | 0: 988 1: 10645 2: 41908 3: 101046 4: 181313 |
||
| Right | 1031618574 | 7:123908916-123908938 | AAGAAGAAGAAGAAGGAAGAAGG | 0: 12 1: 84 2: 343 3: 1478 4: 5646 |
||||
| 1031618571_1031618574 | 22 | Left | 1031618571 | 7:123908871-123908893 | CCACTGCACTCTGGCCTGGGCAA | 0: 414 1: 5963 2: 81323 3: 190415 4: 230730 |
||
| Right | 1031618574 | 7:123908916-123908938 | AAGAAGAAGAAGAAGGAAGAAGG | 0: 12 1: 84 2: 343 3: 1478 4: 5646 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031618574 | Original CRISPR | AAGAAGAAGAAGAAGGAAGA AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||