ID: 1031620198

View in Genome Browser
Species Human (GRCh38)
Location 7:123926258-123926280
Sequence GGCCGGCGGGGAAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 9, 3: 68, 4: 624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031620198_1031620206 2 Left 1031620198 7:123926258-123926280 CCCTCCTTCTTTCCCCGCCGGCC 0: 1
1: 1
2: 9
3: 68
4: 624
Right 1031620206 7:123926283-123926305 CTTTTCCCCTTTAAATACCGAGG 0: 1
1: 0
2: 2
3: 25
4: 125
1031620198_1031620213 28 Left 1031620198 7:123926258-123926280 CCCTCCTTCTTTCCCCGCCGGCC 0: 1
1: 1
2: 9
3: 68
4: 624
Right 1031620213 7:123926309-123926331 TCAAATTCATTTTTAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031620198 Original CRISPR GGCCGGCGGGGAAAGAAGGA GGG (reversed) Intronic
900193515 1:1361767-1361789 GGCCGTAGGAGAAAGAAGGCTGG - Intronic
901222936 1:7594192-7594214 GGAGGGAGGGGAAGGAAGGAAGG + Intronic
901306425 1:8236322-8236344 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
901365073 1:8739986-8740008 GGCAATAGGGGAAAGAAGGAAGG - Intronic
901677267 1:10892935-10892957 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
901692323 1:10981534-10981556 GGCAGGGAGGGAAGGAAGGAAGG + Intronic
901796832 1:11684413-11684435 GGGCGGCTGGGAAGGAAGGATGG + Intronic
902634727 1:17727792-17727814 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
902661876 1:17909949-17909971 GGCTAGGGGGGAATGAAGGAGGG + Intergenic
902837120 1:19054373-19054395 GGCTGGCCGGGAAGGAAGGCAGG + Intergenic
903386897 1:22933003-22933025 GGACACTGGGGAAAGAAGGAAGG - Intergenic
904679702 1:32220881-32220903 GACCAGCGGAGGAAGAAGGAAGG - Intronic
905094422 1:35456890-35456912 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
905215764 1:36406515-36406537 GGAAGGAAGGGAAAGAAGGAAGG - Intergenic
905215768 1:36406532-36406554 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
905215786 1:36406598-36406620 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
905215796 1:36406635-36406657 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
905362044 1:37427599-37427621 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
905362380 1:37429822-37429844 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
907354538 1:53861631-53861653 GGCAGGCAGGGAAGGAAGGAAGG + Intronic
907490334 1:54805316-54805338 GGTTGGGGGGTAAAGAAGGAGGG + Intergenic
907502070 1:54887881-54887903 GCCCGGAGGAGAAAGAATGAAGG + Intergenic
907623380 1:56005082-56005104 GGCCTGAGAGGAGAGAAGGAGGG - Intergenic
907665565 1:56431245-56431267 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
907915149 1:58861392-58861414 GGGAGGCAGGGAAGGAAGGAAGG + Intergenic
908801503 1:67885283-67885305 ATCTGGCGGGGAAAGAAGAAAGG + Intergenic
908862727 1:68507893-68507915 GGCTGGAGGGGAAAGAGAGAGGG + Intergenic
910393560 1:86769123-86769145 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
910757809 1:90710294-90710316 GGAGGGGTGGGAAAGAAGGAGGG - Intergenic
910758955 1:90717316-90717338 GTGGGGCGGGGAGAGAAGGAAGG + Intergenic
911158750 1:94661502-94661524 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
911504540 1:98732367-98732389 GGCTGGAGGGGAAATAGGGAGGG + Intronic
912390091 1:109297023-109297045 GGCCAGCTGGGAAGGAAGGAGGG - Intronic
912497262 1:110099688-110099710 GGCCGGCAGGGAGGGAGGGAAGG + Intergenic
913232440 1:116751801-116751823 GGCCAGAGGGGAAGGAGGGAGGG - Intergenic
915267054 1:154726453-154726475 GGCCTGGGAGGAAAGAAGGTAGG + Intronic
915518347 1:156426916-156426938 GGTCGTCAGGGAAAGAAGGCTGG - Intronic
916348976 1:163827224-163827246 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
916577543 1:166081084-166081106 GGGCGGAGGGGAAAGTGGGAGGG - Intronic
916834965 1:168534173-168534195 GGCAGAAGGGGAAAGAAGGAAGG - Intergenic
917104976 1:171483263-171483285 GGCAGGCAGGCAAGGAAGGAAGG + Intergenic
917104977 1:171483267-171483289 GGCAGGCAAGGAAGGAAGGAAGG + Intergenic
917378386 1:174376242-174376264 GGAAGGAAGGGAAAGAAGGAAGG + Intronic
917523194 1:175764931-175764953 GGCCAGAGGGGAAAGGAGCATGG + Intergenic
917930442 1:179818925-179818947 GGCCGGCGATGAAGGAAGGATGG - Intergenic
918019757 1:180675251-180675273 GGCTGGAGGAGAAAGAGGGAGGG + Intronic
918212313 1:182361990-182362012 GGAAGGGGGGGAAGGAAGGAAGG + Intergenic
919846089 1:201643122-201643144 GGAAGGAAGGGAAAGAAGGAAGG - Intronic
919987282 1:202684785-202684807 GGCCTGTGGGGACAGAAGGTAGG - Intronic
920360334 1:205411023-205411045 GGAAGGAAGGGAAAGAAGGAAGG + Intronic
920437513 1:205956989-205957011 GGCAAGTGGGGAAAGAAGGCAGG - Intergenic
920913980 1:210243678-210243700 GGCTGGAGTGGAAGGAAGGATGG - Exonic
922333887 1:224603073-224603095 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
922612180 1:226938945-226938967 GGCTGGAGGGGGAAGATGGAAGG + Intronic
922724048 1:227914424-227914446 GGAGGGAGGGGAAAGGAGGAGGG - Intergenic
923129684 1:231064663-231064685 GGGAGGAAGGGAAAGAAGGAAGG - Intergenic
923455814 1:234164353-234164375 GGAGAGAGGGGAAAGAAGGAGGG - Intronic
923482488 1:234397538-234397560 GGGAGGAGGGGAAAGAGGGAGGG + Intronic
923683642 1:236139716-236139738 GGAGGGAGGGGAAAAAAGGAAGG - Intergenic
923702410 1:236312486-236312508 GGGAGGCGGGGAAACAAGGATGG + Intergenic
923810614 1:237310557-237310579 GGCTGGAGGGGAAAGAGGTAGGG - Intronic
923821445 1:237447831-237447853 GGAGGGAGGGGAAAGAGGGAGGG - Intronic
924116517 1:240753140-240753162 GGCAGGGAGGGAAAGAAGAAAGG - Intergenic
924433941 1:244022092-244022114 GGCCGGCGGGGCAGGCAGGATGG - Intergenic
1063188179 10:3668909-3668931 AGCCGGCGGGGAAGCCAGGATGG + Intergenic
1063349137 10:5338232-5338254 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1063399202 10:5725439-5725461 GGCAGGAGGGGCAAGAAGCAAGG + Intronic
1063522500 10:6753586-6753608 GGTAGGTAGGGAAAGAAGGAAGG - Intergenic
1063713105 10:8499971-8499993 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1065022313 10:21510350-21510372 GGCGGGCTGGGAAGGAAGGCAGG - Intergenic
1065077633 10:22097550-22097572 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1065514065 10:26507040-26507062 GGGAGGTGGGGAAAAAAGGAAGG + Intronic
1065579394 10:27155656-27155678 AGCCGGTGGGGCAGGAAGGAGGG - Intronic
1065951631 10:30657754-30657776 GGGAGGAGGGAAAAGAAGGAGGG - Intergenic
1066355860 10:34683241-34683263 GGGAGGCGGGGAGAGAAGCAAGG + Intronic
1066479752 10:35784364-35784386 GGCGGTCGGGGAAGAAAGGATGG - Intergenic
1066557995 10:36636617-36636639 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1066569390 10:36754380-36754402 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1067059910 10:43072980-43073002 GGGCAGAGGGGAAAGAAGAAAGG + Intergenic
1068942479 10:62693163-62693185 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1069635985 10:69925195-69925217 GGCTGGAGGGGAAAGAGGAAGGG + Intronic
1069681169 10:70286476-70286498 GGCTGCTGAGGAAAGAAGGAAGG - Intergenic
1070634489 10:78113534-78113556 GGATGGAGGGAAAAGAAGGAAGG - Intergenic
1070984055 10:80672984-80673006 GGCCTGGGCGGAAAGAAAGAGGG + Intergenic
1071827120 10:89336225-89336247 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1071955320 10:90751393-90751415 GGCTGCTGGGGAAATAAGGAAGG - Intronic
1072420760 10:95289525-95289547 GGCCAACCGGGAAAGAAGCATGG + Intronic
1072446209 10:95500972-95500994 GGAAGGCGGGGAAGGAAGAAGGG - Intronic
1073062035 10:100738967-100738989 GGCCCTCGGGGAAAGGGGGAAGG - Intronic
1073178359 10:101569881-101569903 GGTGGGCGGGGAAAGAGGGATGG + Intergenic
1074300644 10:112230578-112230600 GGAAGGGAGGGAAAGAAGGAGGG + Intergenic
1075153157 10:119953450-119953472 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1075153166 10:119953478-119953500 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1075468355 10:122669144-122669166 GGCTGGAAGGGAAAGAGGGAGGG + Intergenic
1075482716 10:122796297-122796319 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
1076206887 10:128610829-128610851 GGCAGGCAGGGAAGGTAGGAAGG - Intergenic
1076272417 10:129165955-129165977 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1076749502 10:132535570-132535592 GGCTGGCGAGGAGAGGAGGAGGG + Intergenic
1076753484 10:132555418-132555440 GGCCGGAAGGGGAAGAAGGGGGG + Intronic
1077145897 11:1044477-1044499 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1077476172 11:2791585-2791607 CGCGGGCGGGGAAGGAAGGACGG + Intronic
1077662905 11:4085043-4085065 GGCTGGGAGGGAAAGAGGGAAGG + Intronic
1077664533 11:4095497-4095519 GGGCAGCTAGGAAAGAAGGAGGG + Intronic
1078101510 11:8332907-8332929 GGGCGGCGGGGAATGCAGGGAGG + Intergenic
1078241431 11:9534286-9534308 GGCTGGAGGGGAAAGACGGAGGG - Intergenic
1078594668 11:12675266-12675288 GGGCGGCGGCGAAAGCAGGGGGG - Intronic
1079361978 11:19777202-19777224 GGCCGGCGGGGAGCGAGCGAGGG + Intronic
1080891185 11:36410391-36410413 GGCAGGCAGGCAAAGAAGGGAGG - Intronic
1081574399 11:44310192-44310214 GGCCGGCGTGGAGGGGAGGAGGG - Intergenic
1081693687 11:45094890-45094912 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
1081952368 11:47055334-47055356 GGAGGGAGGGGAAGGAAGGAAGG - Intronic
1082816028 11:57509708-57509730 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1083542971 11:63527526-63527548 GGTTGGAGGGGAAAGAGGGAGGG - Intergenic
1083549049 11:63572065-63572087 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1083734469 11:64671527-64671549 GGCCGGTGGGGGAGGAGGGAAGG + Intronic
1084079361 11:66810541-66810563 GGCTGGAGAGGAAAGATGGAGGG + Intronic
1084286975 11:68138148-68138170 GGCTGGAGGGGAAGGAGGGAGGG + Intergenic
1084374621 11:68767899-68767921 GGCAGGAGGGGAAGGAAGGGAGG - Intronic
1084441841 11:69179071-69179093 GGAAGGAGGGGAAGGAAGGAGGG + Intergenic
1084596769 11:70121174-70121196 GGGAGACGGGGAGAGAAGGAGGG - Intronic
1084645617 11:70455749-70455771 GGCAGGAGGGGAAGGAAGGGAGG + Intergenic
1084914889 11:72421288-72421310 GGAAGGAGGGGCAAGAAGGAAGG - Intronic
1085543011 11:77289748-77289770 GGCAGGCAGGGAAGGAAGGAGGG + Intronic
1086348140 11:85918754-85918776 GGCTGGAGGGGAAAGCAGGAAGG + Intronic
1087471458 11:98580841-98580863 GGAGGGAGGGGAAAGAGGGAGGG + Intergenic
1087906079 11:103699654-103699676 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
1088246173 11:107820296-107820318 GGAGGGAGGGGAAGGAAGGAAGG + Intronic
1089099266 11:115947264-115947286 GGAGGGAGGGGAAAGAAGGAAGG + Intergenic
1089196359 11:116696054-116696076 GGGAAGCAGGGAAAGAAGGAGGG - Intergenic
1089273126 11:117315421-117315443 GGCTGGTGGGGACAGCAGGAGGG - Intronic
1090386372 11:126359751-126359773 GGCCCACGGGGAAGGAGGGAAGG - Intronic
1090576054 11:128105227-128105249 GGCAGGAGGGGAAGGAGGGAAGG - Intergenic
1091863699 12:3810633-3810655 GGGAGGGAGGGAAAGAAGGAAGG + Exonic
1092085349 12:5753249-5753271 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1092170360 12:6370472-6370494 GGCCACCGGGGTAAGAGGGAGGG - Intronic
1092386414 12:8038842-8038864 GCCTGGCTGGGAAGGAAGGAGGG + Intronic
1094018577 12:25889947-25889969 GGCTGGAGGGAAAAGAGGGAGGG + Intergenic
1094526163 12:31232578-31232600 AGCAGGCGGGGAAAGATGCAGGG + Intergenic
1095432053 12:42144783-42144805 GGTGGGCGGGGAGGGAAGGAAGG - Exonic
1095672417 12:44876377-44876399 GGGAGGCGGGGTAAGGAGGAGGG + Intronic
1095857252 12:46873940-46873962 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1096121896 12:49093936-49093958 CGAGGGCGGGGAAAGGAGGATGG - Intronic
1096191318 12:49622196-49622218 GGCGGGCGGGGGGAGGAGGACGG - Intronic
1096509989 12:52122303-52122325 GACGGGCAGGGAGAGAAGGAGGG + Intergenic
1096783421 12:54003781-54003803 GGATGGCTGGGAAAGAAGGCTGG + Intronic
1096867929 12:54576239-54576261 TGCCGTCAGGGACAGAAGGATGG + Intronic
1096905806 12:54934267-54934289 GGTGGGTGGGGAAAGGAGGAAGG + Intergenic
1097695361 12:62769851-62769873 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1097698563 12:62798213-62798235 GGCCGGAGGGGAAAGAGGGAGGG + Intronic
1098255521 12:68611398-68611420 AGCCGGCGGGGAAAGGAGGGCGG - Intronic
1098567927 12:71956487-71956509 GGGAGGGAGGGAAAGAAGGAGGG - Intronic
1099304558 12:80937576-80937598 GGCAGGCGGGGAAGGGAGGAGGG + Intronic
1099564220 12:84220018-84220040 GGCTAGAGGGGAGAGAAGGAGGG - Intergenic
1100301398 12:93311109-93311131 GGCGTGGGGAGAAAGAAGGAAGG + Intergenic
1100756975 12:97762105-97762127 GGCTGGAGGGAAAAGAGGGAGGG - Intergenic
1100966522 12:100019185-100019207 GGCTGGAGGGGAAGGAGGGAGGG + Intergenic
1101278501 12:103226823-103226845 AGGCGGGAGGGAAAGAAGGAAGG + Intergenic
1101410980 12:104468123-104468145 GGGAGGCGGGGAAGCAAGGAAGG + Intronic
1101879579 12:108617126-108617148 TGCCAGCAGGGAAGGAAGGAGGG - Intergenic
1101952669 12:109188528-109188550 GGAAGGGAGGGAAAGAAGGAAGG - Intronic
1102277916 12:111597992-111598014 GTCTGGCGGGGGAAGGAGGAAGG + Intronic
1102508045 12:113396512-113396534 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1102557300 12:113735595-113735617 GGCCGGCAGGAGAAGCAGGAAGG + Intergenic
1102864068 12:116360386-116360408 GGAGGGGAGGGAAAGAAGGAAGG - Intergenic
1102886392 12:116525348-116525370 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
1103408082 12:120689769-120689791 GGCAGGCGGGAAAAGAAATAAGG - Intronic
1103423017 12:120805068-120805090 GGCGGGCAGGGAAAGAGGAATGG + Intronic
1103561514 12:121795424-121795446 GGCAGGCAGGGAAAGTAGGGTGG + Intronic
1103703526 12:122859836-122859858 GGCCTGGGGGGACAGAAGGGGGG - Intronic
1104040218 12:125125047-125125069 GGCCGGCGGGGATGGCTGGAAGG - Intronic
1104414821 12:128589387-128589409 GGCAGGCGGGGTGAGAGGGACGG - Intronic
1104685197 12:130780432-130780454 TCCGGGCGGGGAAAGAAGGTAGG - Intergenic
1105602971 13:21903366-21903388 GGCCGGGGGGGAAGGAGGGACGG - Intergenic
1105843932 13:24278997-24279019 GGGAGGCAGGGAAGGAAGGAAGG - Intronic
1106646389 13:31638808-31638830 AGCTGGCTGGGAGAGAAGGAAGG - Intergenic
1107511753 13:41092329-41092351 GGCTGGAGGAGAAAGAAGGAGGG + Intergenic
1108362914 13:49683775-49683797 AGCCGCCGTGGAAAGCAGGATGG + Intronic
1109108402 13:58284704-58284726 GGCAGGGAGGGAAAGAAGGAAGG + Intergenic
1109370661 13:61416073-61416095 GGGAGGGGGGGAGAGAAGGAAGG - Intronic
1110237544 13:73232428-73232450 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1110863684 13:80371498-80371520 TGCCGGCGTGGAAACAGGGAAGG - Intergenic
1111330874 13:86761148-86761170 GGCGGGCAGGGACAGAAGAAAGG + Intergenic
1112484436 13:99807653-99807675 GGCCGGGGGGGAAGGAGGAACGG + Intronic
1113629068 13:111868660-111868682 GGGCGGTGGGGAAAGGAGGAAGG - Intergenic
1113891511 13:113738070-113738092 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1113938087 13:114005729-114005751 GGCCGGAGGGGAGAAAGGGATGG - Intronic
1114515616 14:23298004-23298026 GGCCAGTGGGGGAAGAGGGAGGG + Exonic
1114541887 14:23466838-23466860 GGCTGGAGGAGAAAGAGGGAGGG + Intergenic
1114558754 14:23576962-23576984 GGTGGCGGGGGAAAGAAGGATGG + Intronic
1114673491 14:24427211-24427233 GGCTGGTGAGGAAGGAAGGAGGG - Exonic
1114993725 14:28319556-28319578 GGGAGGCAGGGAAGGAAGGAAGG + Intergenic
1116201943 14:41808365-41808387 GGAAGGAAGGGAAAGAAGGAAGG + Intronic
1116264597 14:42671491-42671513 GGGAGGCAGGGAGAGAAGGAGGG - Intergenic
1116647964 14:47553989-47554011 GGTGGACGGGGAAAGGAGGAAGG - Intronic
1117003610 14:51395879-51395901 GGAAGGAAGGGAAAGAAGGAAGG - Intergenic
1117084640 14:52186840-52186862 GGCTGAAGGGGAAAGATGGAAGG + Intergenic
1117302909 14:54446151-54446173 AGGAGGAGGGGAAAGAAGGAGGG - Intergenic
1117474804 14:56083305-56083327 GGCAGGTAGGGAAAGAAGAAGGG - Intergenic
1118816244 14:69316255-69316277 GGATGGTGGGGAAAGGAGGAAGG + Intronic
1119632978 14:76250132-76250154 GGTTTGCGGAGAAAGAAGGAGGG - Intronic
1120367724 14:83591962-83591984 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
1121612819 14:95293183-95293205 GGAAGGGGGGGAAAGAAGGAGGG - Intronic
1121743221 14:96268413-96268435 GGCCGGCTGAAAAAGAAGAAAGG - Intronic
1122074087 14:99224597-99224619 GGCCGGTGGGAAGGGAAGGAGGG - Intronic
1123040957 14:105490109-105490131 TGCGGGCGGGGAAGGACGGAGGG + Intronic
1124172463 15:27388099-27388121 GGAGGGAGGGAAAAGAAGGAAGG + Intronic
1124172524 15:27388309-27388331 GGAGGGAGGGAAAAGAAGGAAGG + Intronic
1124172550 15:27388393-27388415 GGAGGGAGGGGAAGGAAGGAAGG + Intronic
1125066979 15:35499314-35499336 AACCTGGGGGGAAAGAAGGAAGG - Intronic
1125121243 15:36161179-36161201 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1126151364 15:45526230-45526252 GGCAGGCAAGGAAGGAAGGAAGG - Intergenic
1126272038 15:46831329-46831351 GGAAGACGGGGAAGGAAGGAGGG + Intergenic
1126844660 15:52747582-52747604 GACTGGAGGGGAAAGAGGGAAGG - Intergenic
1127415082 15:58749755-58749777 GGAAAGCGGGGAAAGGAGGAAGG - Exonic
1127660759 15:61098135-61098157 GGGAGGGAGGGAAAGAAGGAGGG - Intronic
1127830824 15:62749597-62749619 GGGGGGCTGGGAGAGAAGGAAGG - Intronic
1128149322 15:65353212-65353234 GGAGGGAGGGGAAGGAAGGAAGG - Intronic
1128155899 15:65391853-65391875 GGGCGGTGGGGGAAGAAGGCGGG - Intronic
1128613849 15:69094316-69094338 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1128930217 15:71697507-71697529 GGCAGGCAGGCAAAGAAGTAGGG + Intronic
1129237062 15:74230014-74230036 GGCTGGCTGGGGAAGAGGGATGG + Intergenic
1129467664 15:75732934-75732956 GGCCGGCAGGGAAAGGAGGCCGG + Intergenic
1129719548 15:77870655-77870677 GGCCGGCAGGGAAAGGAGGCCGG - Intergenic
1129926107 15:79365537-79365559 GACTGGAGGGGAAAGAAGGAGGG + Intronic
1130175913 15:81570623-81570645 AGAAGGTGGGGAAAGAAGGATGG - Intergenic
1130934714 15:88459145-88459167 GGAAGGGGGGGAAAGAAGGAAGG + Intergenic
1131465968 15:92655280-92655302 GGCCGGCGGGGGAAGGAAGAGGG + Intronic
1131620596 15:94064170-94064192 GGAGGGAGGGAAAAGAAGGAAGG + Intergenic
1131796991 15:96029174-96029196 GGAGGGAGGGGAAAGAAGGAAGG + Intergenic
1132123489 15:99198357-99198379 GGATGTGGGGGAAAGAAGGAAGG - Intronic
1132180718 15:99750760-99750782 GGCAGGAGGGGAAGGAGGGAGGG - Intergenic
1132195375 15:99910660-99910682 GGCTGGAGGGGAACGAGGGAGGG + Intergenic
1132315771 15:100889386-100889408 GGCTGACTGGGAAGGAAGGAAGG - Intronic
1133589597 16:7229729-7229751 GGAGGGAGGGGGAAGAAGGAAGG + Intronic
1133711730 16:8408177-8408199 GGGCTGCTGGAAAAGAAGGAAGG - Intergenic
1133853162 16:9524977-9524999 GGAAGGCTGAGAAAGAAGGAGGG - Intergenic
1134104322 16:11475134-11475156 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1134308421 16:13054367-13054389 GGATGGATGGGAAAGAAGGAGGG - Intronic
1134374516 16:13659438-13659460 GGCCGGCCAGGAAAGAAATATGG + Intergenic
1134648772 16:15891707-15891729 GGGCGGGGAGGAAGGAAGGAAGG - Intergenic
1135521460 16:23181818-23181840 GGCAGGCAGGCAAGGAAGGAAGG + Intergenic
1135651813 16:24212933-24212955 GGCCAGCGGGAAGACAAGGATGG - Intronic
1135779695 16:25289569-25289591 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1135784449 16:25336079-25336101 TGCAGGCTGGGAAGGAAGGAAGG - Intergenic
1135795065 16:25433825-25433847 GGACGGAAGGGAAGGAAGGAAGG - Intergenic
1135939562 16:26809630-26809652 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
1136568558 16:31083807-31083829 GGCCTGTGGGGAAGGAAGGAGGG + Exonic
1137476237 16:48811767-48811789 GGGAGGCGGGGCAAGAAGGATGG - Intergenic
1138207086 16:55133097-55133119 GGCCGGCGGAGAAAGAAAATGGG + Intergenic
1140333073 16:74076529-74076551 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1140388161 16:74560836-74560858 GGAAGGGAGGGAAAGAAGGAAGG + Intronic
1140436245 16:74949428-74949450 GGGAGGGAGGGAAAGAAGGAGGG + Intronic
1140692617 16:77498837-77498859 GGCGGGGGAGGAAGGAAGGATGG + Intergenic
1140728917 16:77838649-77838671 GGCAGGGAGGGAAAGGAGGAGGG - Intronic
1140795633 16:78434890-78434912 GGCATGTGGGAAAAGAAGGAAGG + Intronic
1140910401 16:79446103-79446125 GGGCAGAGGGGAAAGGAGGAAGG + Intergenic
1141189931 16:81817081-81817103 GGCTGGTGGGGAGAGACGGATGG + Intronic
1141556883 16:84842282-84842304 GGCAGGCGGGGAGGGAGGGAGGG - Intronic
1141668482 16:85478987-85479009 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1141683132 16:85555572-85555594 GGGTGGCGGGGAGAGGAGGAGGG - Intergenic
1142549837 17:732129-732151 GGCCCGCGGGGAAGGAAGGAGGG - Intergenic
1142956792 17:3528124-3528146 GGCCTGCAGGGAAAGAAGAGGGG + Exonic
1143249417 17:5511722-5511744 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1144707641 17:17380160-17380182 GGAAGGCGGGGAGAGAAAGAGGG + Intergenic
1145404338 17:22571860-22571882 GGCGGTCGGGAAAAGAAGGTAGG + Intergenic
1145836540 17:27958385-27958407 GGCCGGCGGGTGGGGAAGGAAGG - Intergenic
1146275526 17:31513448-31513470 GGCCGGCGGGAGAAGGAGCAAGG + Intronic
1146285486 17:31571649-31571671 GGCTGGGGTGGACAGAAGGAGGG + Intronic
1146342558 17:32033349-32033371 GGAGGGAAGGGAAAGAAGGAGGG + Intronic
1146726442 17:35160103-35160125 GCCTGGAGGGGAAAGAGGGAGGG + Intronic
1147252489 17:39161411-39161433 GACCAGTGGGGAAAGAAAGAGGG - Intronic
1147565416 17:41533294-41533316 GGAGGGGAGGGAAAGAAGGAGGG + Intergenic
1148210340 17:45804704-45804726 GGCAGGCAGGGAAGGAGGGATGG + Intronic
1148431933 17:47649953-47649975 GGCGGAGGGAGAAAGAAGGAAGG - Exonic
1148810300 17:50286038-50286060 GGAGGGAGGGGAAGGAAGGAAGG - Intergenic
1149563240 17:57624504-57624526 ACCCGACGGAGAAAGAAGGAAGG - Intronic
1149985736 17:61345516-61345538 GGAAGGAAGGGAAAGAAGGAGGG + Intronic
1150150653 17:62806585-62806607 GGCAGGTGGAGAAGGAAGGAGGG + Intronic
1150332918 17:64308808-64308830 GGCCCTCTGGGAAAGAAGCAAGG - Intergenic
1151205047 17:72500450-72500472 GGGCAGGGGGAAAAGAAGGATGG + Intergenic
1151632281 17:75319043-75319065 GGCCACCGGGGCAAGAGGGAAGG - Exonic
1152265676 17:79293312-79293334 GGCAGGGAAGGAAAGAAGGAAGG - Intronic
1152463937 17:80455268-80455290 TGCAGCAGGGGAAAGAAGGAGGG + Intergenic
1152793830 17:82296954-82296976 GGCGGGAAGGGAAGGAAGGATGG - Intergenic
1153254785 18:3159945-3159967 GGCAGGCAGGGAAGGAAGGAGGG - Intronic
1156495903 18:37524986-37525008 GGCAGGCGGAGAGAGAAGAAAGG - Intronic
1156843793 18:41639306-41639328 GGAGGGAGGGGAAGGAAGGAGGG + Intergenic
1156843811 18:41639494-41639516 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1157496617 18:48161542-48161564 GGCCGGCAGGGAGAGAAAGGTGG - Intronic
1157499576 18:48180139-48180161 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1157671793 18:49536466-49536488 GGCTGGAGAGGAAAGAGGGAGGG - Intergenic
1157689505 18:49669409-49669431 GGCAGACGTGGAAAGAAAGAAGG - Intergenic
1157892076 18:51427413-51427435 GGCTGGAGGGGAAACAGGGAGGG - Intergenic
1158525010 18:58205520-58205542 GGTTGGCAGGGAGAGAAGGAGGG + Intronic
1158745154 18:60191227-60191249 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
1158801463 18:60915346-60915368 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1160037105 18:75311421-75311443 AGCTGATGGGGAAAGAAGGAGGG - Intergenic
1160356173 18:78229759-78229781 GGTAGGGAGGGAAAGAAGGAGGG - Intergenic
1160443711 18:78911932-78911954 GGCCTGAGGTGACAGAAGGAGGG - Intergenic
1160563112 18:79771448-79771470 GGCCGGCGTGGAGGGGAGGACGG - Intergenic
1160830709 19:1103862-1103884 GGCCGGAGTGGGAAGAAGGCGGG - Intergenic
1160835289 19:1122073-1122095 GGTCGGAGGGAAAAGGAGGATGG - Intronic
1160970152 19:1764417-1764439 GGCTGGCGGGGAAAGCTGGAGGG + Intronic
1161130332 19:2584774-2584796 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1161259908 19:3332182-3332204 GGACGGGAAGGAAAGAAGGAAGG - Intergenic
1161371365 19:3913737-3913759 CGCTGGCGGGGGGAGAAGGAGGG - Exonic
1161421683 19:4179295-4179317 GGCAGGCCGGGAGAGATGGACGG + Intronic
1161535960 19:4818588-4818610 GGCAGGCGGGGAAAGCAGGCGGG - Intronic
1161833369 19:6627010-6627032 GGAGGCAGGGGAAAGAAGGAAGG - Intergenic
1161872893 19:6884320-6884342 GGCCAACGGGGAAAGAATGAAGG + Intergenic
1162338525 19:10076774-10076796 GGCAGGGAGGGAAGGAAGGAAGG + Intergenic
1162811664 19:13167785-13167807 GGCAGCAGGGGAGAGAAGGAAGG - Intergenic
1162950520 19:14069613-14069635 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1163017290 19:14464162-14464184 GGCCTACGGGGATAGAAGGGGGG - Intronic
1163321140 19:16575780-16575802 GGACCGCGTGGAAGGAAGGACGG - Exonic
1163488400 19:17603012-17603034 GTCCTGAGGGGAAGGAAGGAGGG + Exonic
1163538474 19:17892322-17892344 GGAGGGAGGGAAAAGAAGGAAGG + Intronic
1163722010 19:18902759-18902781 GGAAGGAAGGGAAAGAAGGAAGG + Intronic
1163779771 19:19240116-19240138 GGCAGGAGTGGGAAGAAGGATGG - Intronic
1164573219 19:29388871-29388893 TACTGGGGGGGAAAGAAGGAGGG + Intergenic
1164771837 19:30815827-30815849 GGGAGGAAGGGAAAGAAGGAAGG - Intergenic
1164975605 19:32570870-32570892 GGGAGGAAGGGAAAGAAGGAAGG - Intergenic
1165056849 19:33182816-33182838 GGCAGGCGGGGAGAGAAGGGTGG + Intronic
1165412519 19:35670664-35670686 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1165725906 19:38112760-38112782 TGCCTGTGGGGAAAGAGGGATGG - Intronic
1166194733 19:41198352-41198374 GGGAGGCAGGGAAAGATGGATGG - Intronic
1166502176 19:43349897-43349919 GGCTGGCGGTGAAAGAAGGAGGG + Intergenic
1166507934 19:43383552-43383574 GGCTGGCGGTGAAAGAAGGAGGG - Intergenic
1167130451 19:47582029-47582051 GGGAGGCAGGGAAGGAAGGAAGG - Intergenic
1167206478 19:48105877-48105899 GGGAGGGAGGGAAAGAAGGAGGG - Intronic
1167220853 19:48197111-48197133 GTCAGGCTGGGACAGAAGGAAGG + Intronic
1167622866 19:50568639-50568661 GGAAGGGGAGGAAAGAAGGAAGG + Intergenic
1167679968 19:50913057-50913079 GGCTGTGGGGGAAAGAAGTAAGG - Intergenic
1167857663 19:52255855-52255877 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1168269392 19:55241428-55241450 GGGAGGCGGGGGAAGCAGGAAGG - Intronic
925651657 2:6096641-6096663 TGCAGGGGAGGAAAGAAGGAAGG + Intergenic
926161837 2:10494962-10494984 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
926420151 2:12687819-12687841 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
928093964 2:28392924-28392946 GCTCGGCGGGGACAGAAAGAGGG + Exonic
929310561 2:40419480-40419502 GGTAGGCAGAGAAAGAAGGAGGG - Intronic
929372981 2:41249658-41249680 GGGAGGGAGGGAAAGAAGGATGG + Intergenic
930041967 2:47132196-47132218 GGAAGGTAGGGAAAGAAGGAAGG + Intronic
930424980 2:51201685-51201707 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
932608806 2:73183304-73183326 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
932694625 2:73944954-73944976 GGCTTGCGGGGTCAGAAGGAGGG + Intronic
933437082 2:82261655-82261677 GGCTAGAGGGGAAAGATGGAGGG - Intergenic
933738834 2:85517027-85517049 GGTCGGGGGAGACAGAAGGAGGG + Intergenic
934046932 2:88180031-88180053 GGCTGGCAGGCAAAGAGGGATGG + Intronic
934710037 2:96508636-96508658 GCCCGGCGGGGAACGGATGAGGG - Intergenic
935131300 2:100263118-100263140 GGAGGGAGGGGAAGGAAGGAGGG - Intergenic
935173689 2:100629689-100629711 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
935319909 2:101876311-101876333 GGCAGGTGTGGAAATAAGGAAGG + Intronic
935713016 2:105915980-105916002 GGCTGGAGGGGAGAGAGGGAGGG + Intergenic
936259123 2:110943168-110943190 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
936590011 2:113794565-113794587 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
937024975 2:118690404-118690426 GGAAGGGAGGGAAAGAAGGAGGG + Intergenic
937356872 2:121203216-121203238 GGCCGGTGGGTAAAGAGAGAAGG + Intergenic
937399547 2:121570174-121570196 GGTGGGGAGGGAAAGAAGGAGGG - Intronic
937845022 2:126570100-126570122 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
938097466 2:128473117-128473139 GTCCTGCGGGGATGGAAGGAGGG - Intergenic
938145582 2:128832482-128832504 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
938287741 2:130130955-130130977 GGCGGTCGGGAAAAGAAGGTGGG + Intergenic
938312086 2:130300184-130300206 GGCGGTCGGGAAAAGAAGGTGGG - Intergenic
938427850 2:131207903-131207925 GGCGGTCGGGAAAAGAAGGTGGG - Intronic
938468772 2:131541928-131541950 GGCGGTCGGGAAAAGAAGGTGGG - Intergenic
939138665 2:138326423-138326445 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
939287035 2:140145030-140145052 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
939500141 2:142974247-142974269 GGCTGGAGGGGAAAGAGGAAGGG + Intronic
940324487 2:152411064-152411086 TGCTGGGGGGCAAAGAAGGAGGG - Intronic
941361063 2:164551908-164551930 TGCAGGCTGGAAAAGAAGGATGG + Intronic
941400105 2:165020241-165020263 GGCAGGAAGGGAAGGAAGGAAGG - Intergenic
941569215 2:167148482-167148504 GGAGGGAGAGGAAAGAAGGAAGG + Intronic
941901831 2:170686320-170686342 GGGAGGGGAGGAAAGAAGGAGGG + Intergenic
942047601 2:172108866-172108888 GGGCGGTGGGGAAAGGAAGAGGG - Intergenic
942748772 2:179264811-179264833 GCCCGGCGCGGGAAGGAGGAAGG + Intergenic
944352176 2:198742108-198742130 GGCAGGCAGGGAAGGAGGGAGGG - Intergenic
945242283 2:207686952-207686974 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
946853200 2:223927938-223927960 GGGAGGCAGGGAAAGAGGGAGGG + Intronic
947249113 2:228081263-228081285 GGCTGGAGGGGAAAGAGAGAGGG - Intronic
948519925 2:238529660-238529682 GGCAGGCAGGGGAAGAAGGGGGG + Intergenic
1169072017 20:2738594-2738616 GGCCTGAGGGGAGAGGAGGAAGG - Intronic
1169367370 20:5001825-5001847 GGCAGGCGGGGTAAAAAGGGGGG - Intronic
1169755950 20:9043397-9043419 GGCTGGAAGGGAAAGAGGGAAGG + Intergenic
1169804942 20:9549865-9549887 AGCTGGAGGGGAAAGAGGGAGGG - Intronic
1169922781 20:10753194-10753216 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1170564311 20:17588067-17588089 GCCTGGAGGGGAAAGAAGGAGGG - Intronic
1170897765 20:20431348-20431370 GGCTGGAGGGGGGAGAAGGAAGG + Intronic
1171368103 20:24640460-24640482 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1171511403 20:25687843-25687865 GGCTGGAGGGGAAAGAGGAAAGG - Intronic
1171562476 20:26137359-26137381 GGCGGTCGGGAAAAGAAGGTAGG + Intergenic
1171970027 20:31558580-31558602 TGAAGGAGGGGAAAGAAGGAAGG - Intronic
1172740671 20:37164208-37164230 GGGAGGCAGGGAAGGAAGGAAGG - Intronic
1173033818 20:39389407-39389429 GATGGGAGGGGAAAGAAGGATGG - Intergenic
1173438818 20:43057249-43057271 GGAGGGTGGGGAATGAAGGAAGG + Intronic
1173660831 20:44732284-44732306 GGCTGGAGGGGAAAGAAGGAGGG + Intergenic
1174296692 20:49550361-49550383 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1174533785 20:51235653-51235675 GGCTGGAGGGGAAGGAGGGAGGG + Intergenic
1174583279 20:51588463-51588485 GGCAGGAGGGAAAAGAAGGTGGG - Intergenic
1175130008 20:56782046-56782068 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175130019 20:56782082-56782104 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175130029 20:56782118-56782140 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1175130038 20:56782142-56782164 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175130049 20:56782178-56782200 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175130060 20:56782214-56782236 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175130071 20:56782250-56782272 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175326364 20:58131322-58131344 GGCCGGTGGGGGGAGGAGGAAGG - Intergenic
1175392444 20:58635897-58635919 GGCAGGAAGGGAAAGAAGGAAGG + Intergenic
1175935999 20:62514280-62514302 GCCCGCCGGGGAAAGGAGGCAGG + Intergenic
1175956270 20:62611009-62611031 GGCTGGCTGGGAAGGAAGCAGGG + Intergenic
1176548897 21:8213227-8213249 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1176556792 21:8257440-8257462 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1176567828 21:8396262-8396284 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1176575731 21:8440481-8440503 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1176648872 21:9528284-9528306 GGCCGCCGGGAAAAGAAGGTAGG - Intergenic
1176906901 21:14511998-14512020 GGTCGGGGGAGAAAGAATGAGGG + Intronic
1177786351 21:25675542-25675564 GGAAGGAGGGGAAGGAAGGAAGG + Intronic
1178113518 21:29394160-29394182 GGCAGGCAGGGCAAGAATGAAGG - Intronic
1178505024 21:33155130-33155152 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1178529830 21:33366667-33366689 GGCTGGTATGGAAAGAAGGAGGG - Intergenic
1178916572 21:36708490-36708512 TGCCGGCGGTGAGAGAGGGATGG - Intronic
1179100495 21:38351746-38351768 GGCAGGAAAGGAAAGAAGGAAGG + Intergenic
1179521130 21:41945763-41945785 GGCAGGAGAGGGAAGAAGGAAGG - Intronic
1179633457 21:42692710-42692732 TGCCGGCGAGGGAAGAGGGACGG - Intronic
1181441498 22:22938213-22938235 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1182106860 22:27695849-27695871 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1182331723 22:29555730-29555752 GGCAGGCAGGGAAAGTAGAAAGG + Exonic
1182453065 22:30432629-30432651 GGCTGGCAGGGAAATAAGGGGGG - Intergenic
1182753568 22:32660561-32660583 GGCTGGCGGGGAAGGAATGGTGG + Intronic
1183173696 22:36206217-36206239 GGCAGGCGTGGAAGGAGGGAAGG + Intergenic
1184403040 22:44284930-44284952 GGCAGGCTGTGAAGGAAGGAAGG - Intronic
1184865418 22:47199422-47199444 GGCCGGCGTGGCCAGAGGGAGGG - Intergenic
1185031132 22:48443574-48443596 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
1185218572 22:49617366-49617388 GGCTGGTGGGTAGAGAAGGAGGG - Intronic
1203253782 22_KI270733v1_random:129535-129557 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1203261838 22_KI270733v1_random:174614-174636 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
949341972 3:3040020-3040042 GACCGTCTGGGAAAGAAGGAAGG - Exonic
950047148 3:9955490-9955512 GGACGGCGGGGATAAATGGAAGG + Intergenic
950409060 3:12822904-12822926 GGCAGGGAGGGAAAGAAGGAGGG - Intronic
952134309 3:30399680-30399702 GGGAGGGGAGGAAAGAAGGAAGG + Intergenic
952259319 3:31724378-31724400 GGTGGGAGGGGAGAGAAGGAAGG + Intronic
952623577 3:35376277-35376299 GGGAGGGAGGGAAAGAAGGAGGG + Intergenic
952902656 3:38120356-38120378 GGCCTGGGAGGAAAGGAGGATGG + Intronic
953761320 3:45689428-45689450 GGCGGGCGGAGAGAGAAGGAAGG + Exonic
954336690 3:49922541-49922563 GGGAGGGAGGGAAAGAAGGAGGG + Intronic
954902422 3:54031317-54031339 GGCCAGTGAGGACAGAAGGAGGG - Intergenic
955421509 3:58742825-58742847 GGCAGGAGGGGAAGGAAGAAAGG + Intronic
955463079 3:59206756-59206778 GACAGGAGGGGAAGGAAGGAAGG - Intergenic
956614610 3:71158155-71158177 GGGAGGCAGGGAAGGAAGGAAGG + Intronic
956913638 3:73847428-73847450 GGCTGGAGGGGAAAGGGGGAGGG + Intergenic
958019340 3:87978847-87978869 GACTGGAGTGGAAAGAAGGATGG + Intergenic
959031386 3:101302907-101302929 GGACGTTGGGGAGAGAAGGATGG - Intronic
960915414 3:122689635-122689657 GGCCCGTGGTGAGAGAAGGATGG - Intronic
961369155 3:126419044-126419066 GGGCGGCGGGGGAGGAGGGATGG - Intronic
963115607 3:141726480-141726502 GGGGGAGGGGGAAAGAAGGAAGG + Intergenic
963638712 3:147832886-147832908 GAGGGGAGGGGAAAGAAGGAAGG - Intergenic
963703570 3:148657322-148657344 GGCAGGCAGGGGAAGCAGGAAGG + Intergenic
963820490 3:149887104-149887126 AGCGGGCGGGGAATGAAGAAGGG - Intronic
963913041 3:150831090-150831112 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
964377271 3:156060603-156060625 GGCAGGGAGGGAAGGAAGGAGGG - Intronic
965048496 3:163612239-163612261 GGGAGGCAGGGAAGGAAGGAAGG - Intergenic
965138689 3:164807551-164807573 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
965211580 3:165797111-165797133 GGAAGGGAGGGAAAGAAGGAAGG - Intronic
965282793 3:166775234-166775256 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
965988997 3:174792302-174792324 GGCAGGCAGGGAAGGAAGGAAGG + Intronic
966558335 3:181289439-181289461 GGCCTGCAGAGAAAGAAGGAAGG + Intergenic
966683678 3:182670601-182670623 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
966839569 3:184077726-184077748 AGCCAGAGGGGAAAAAAGGAAGG + Intergenic
967543047 3:190691367-190691389 GGCAGGAAGGGAAGGAAGGAAGG + Intergenic
968222482 3:196948845-196948867 GGAAGGAAGGGAAAGAAGGAGGG - Intronic
968946558 4:3667633-3667655 GGAAGGCAGGGAAGGAAGGAGGG + Intergenic
968947891 4:3675102-3675124 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
969275235 4:6130192-6130214 GGGAGGCAGGGGAAGAAGGAGGG + Intronic
969354470 4:6617360-6617382 GGCCTTTGGGGACAGAAGGAAGG - Exonic
969654223 4:8486991-8487013 AGGCGGGAGGGAAAGAAGGAAGG + Intronic
969666758 4:8561922-8561944 GGCTGGAGGGGAAAAAGGGAGGG + Intronic
970664807 4:18324499-18324521 GGGAGGTGGGGAAAGAAGGCAGG + Intergenic
970828510 4:20307186-20307208 GGGAGTCAGGGAAAGAAGGAAGG - Intronic
971121470 4:23709779-23709801 GGCTGGAGTGGAATGAAGGAAGG - Intergenic
972418279 4:38863799-38863821 GGTGGGAGGGGAGAGAAGGATGG - Intergenic
973063591 4:45761361-45761383 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
973605487 4:52583090-52583112 GGATGGAGGGGAAAGAAGGAAGG + Intergenic
973614679 4:52666437-52666459 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
974291187 4:59933209-59933231 GGAAGGAAGGGAAAGAAGGAAGG - Intergenic
975512918 4:75212944-75212966 GGCCAGGAGGGAAGGAAGGAGGG + Intergenic
975984426 4:80189445-80189467 TGCGGGCTGGGAAAGAGGGAAGG + Intronic
976126567 4:81839397-81839419 GGCAGGTGGGGAAGAAAGGAAGG + Intronic
976138172 4:81961096-81961118 GGCAGGCAGGGAAGGAAGAAAGG + Intronic
977200760 4:94112818-94112840 GGAAGGAGGGGAAGGAAGGAAGG + Intergenic
977499175 4:97816819-97816841 GGCAGGAAGGGAAGGAAGGAAGG - Intronic
978435023 4:108674716-108674738 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
978526013 4:109665966-109665988 GGCAAGAGGGGAAAGAAGAAGGG + Intronic
978581160 4:110232573-110232595 GGGAGGGAGGGAAAGAAGGATGG + Intergenic
979548994 4:121969217-121969239 GGGAGGGAGGGAAAGAAGGAGGG - Intergenic
979746201 4:124216477-124216499 GGCTGGAGGGGAAATAGGGAGGG - Intergenic
980196526 4:129596122-129596144 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
980642128 4:135595166-135595188 GGCTGGCAGGGAAAGGAAGATGG - Intergenic
982227281 4:153177745-153177767 GGATGGGAGGGAAAGAAGGAAGG - Intronic
982414623 4:155114869-155114891 GGCTGGAGGGGAAAAATGGAGGG + Intergenic
982767711 4:159367392-159367414 GGAGAGCAGGGAAAGAAGGAAGG - Intergenic
982882018 4:160731711-160731733 GGAAGGGAGGGAAAGAAGGAAGG - Intergenic
983172305 4:164549801-164549823 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
984443021 4:179797303-179797325 AGCAGGATGGGAAAGAAGGAGGG + Intergenic
985034365 4:185823158-185823180 GGCCGGAGGGGAAAGAAGGAAGG - Intronic
985545995 5:509481-509503 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
985695026 5:1335320-1335342 GGCCTGTGGTGACAGAAGGAGGG - Intronic
986058750 5:4166371-4166393 GGAAGGCAGGGAAGGAAGGAAGG + Intergenic
986330108 5:6711779-6711801 GGGTGGCGGGGAAAGAGGGGTGG + Intergenic
986695838 5:10353832-10353854 GCCGGGCGGGGAAAGAGGGAGGG - Exonic
986711219 5:10489274-10489296 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
986879070 5:12147772-12147794 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
987118477 5:14744921-14744943 GGCGGTGGGGGAAAGAGGGAGGG + Intronic
987360760 5:17104411-17104433 AGGCGAGGGGGAAAGAAGGAAGG - Intronic
987498236 5:18672988-18673010 AGGCGGGAGGGAAAGAAGGAAGG + Intergenic
989277849 5:39610546-39610568 GGCAGGGAGGGAAGGAAGGAAGG - Intergenic
989277981 5:39610899-39610921 GGAGGGAGGGGAAGGAAGGAAGG - Intergenic
990473045 5:56135254-56135276 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
990507477 5:56458907-56458929 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
990870849 5:60430394-60430416 GGCCCTCAGGGAAAGAAGCAAGG - Intronic
990970972 5:61505666-61505688 GGGAGGCAAGGAAAGAAGGAAGG - Intronic
991646696 5:68808042-68808064 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
991949168 5:71931306-71931328 GACTGGAGGGGAAAGAGGGAGGG + Intergenic
991997014 5:72397964-72397986 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
992605059 5:78447832-78447854 GGAGGGAGGGGAAAGAAGGGAGG - Intronic
993149615 5:84144224-84144246 GGGAGGCAAGGAAAGAAGGAAGG - Intronic
994628542 5:102252063-102252085 GGGAAACGGGGAAAGAAGGAAGG + Intronic
994927443 5:106135840-106135862 GGGAGGAAGGGAAAGAAGGAGGG - Intergenic
995562257 5:113395603-113395625 AGCCTGGGGGGAAAGAGGGAGGG - Intronic
995897136 5:117027881-117027903 GGCCAGAGGGGAAGAAAGGAGGG - Intergenic
996416637 5:123217770-123217792 GGGAGGGGTGGAAAGAAGGAAGG + Intergenic
998810612 5:145962662-145962684 GGAGGGGTGGGAAAGAAGGACGG - Intronic
999292698 5:150437110-150437132 GGCAGGCAGGGAGGGAAGGAAGG + Intergenic
999292699 5:150437114-150437136 GGCAGGGAGGGAAGGAAGGAAGG + Intergenic
999751695 5:154632303-154632325 GGAGGGAGGAGAAAGAAGGAAGG - Intergenic
1000333328 5:160223353-160223375 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1000428075 5:161116073-161116095 GGAGGGAGGGAAAAGAAGGAAGG + Intergenic
1000789932 5:165592821-165592843 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1001320440 5:170676155-170676177 GGTAGGGAGGGAAAGAAGGAAGG + Intronic
1001630294 5:173170018-173170040 GGCTGGAAGGGAAAGAGGGAGGG - Intergenic
1002029964 5:176420658-176420680 GGCAGGAGGAGAAAGAAGAAAGG + Intergenic
1002792022 6:443947-443969 GGCCTGCGGGAAAGGAAGGGGGG - Intergenic
1002863972 6:1104857-1104879 GGAAGGCAGGGAAAGAGGGAAGG + Intergenic
1003403401 6:5809348-5809370 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1003655451 6:8002955-8002977 GCCAGTCGGGGCAAGAAGGAAGG + Intronic
1004582723 6:16970017-16970039 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1004766518 6:18734306-18734328 GGAGGGAGGGGAAGGAAGGAAGG - Intergenic
1005158068 6:22831218-22831240 GGACGGGAGGAAAAGAAGGAAGG - Intergenic
1005843431 6:29759494-29759516 GGCAGGTGGGGAGAGAAGGGCGG + Intergenic
1006839376 6:37018585-37018607 GGCCAGCCTGGGAAGAAGGAAGG + Intronic
1007550935 6:42728913-42728935 GGGAGGGAGGGAAAGAAGGAAGG + Intergenic
1007556540 6:42771060-42771082 GGCAGGCTAGGAGAGAAGGAGGG - Intronic
1008516892 6:52326948-52326970 GGCTGGAGGGGAAAGAAGGAGGG + Intergenic
1010429367 6:75761311-75761333 GGGAGGAGGGAAAAGAAGGATGG + Intronic
1010570032 6:77464404-77464426 GGGCGGGGGGAAAAGAGGGAGGG - Intergenic
1014377697 6:120696453-120696475 GGGTGGGAGGGAAAGAAGGAAGG + Intergenic
1014659329 6:124148397-124148419 GGTCGGGGGGGAGATAAGGAAGG - Intronic
1015093357 6:129385255-129385277 GGAAGGGGGGGAAAGAAGGAAGG + Intronic
1015965536 6:138692906-138692928 GGCCGGGCGGGCAGGAAGGACGG + Intergenic
1016445920 6:144132230-144132252 GGAGGGGAGGGAAAGAAGGAAGG - Intergenic
1016540157 6:145155802-145155824 GGCTGGAGGGGAAACAAGGAAGG - Intergenic
1017743869 6:157429615-157429637 GGAAGGAGGGGAAAGAAGGAAGG + Intronic
1018149643 6:160926175-160926197 GTCCTGCGGGGAAAGGAGAAAGG + Intergenic
1018691986 6:166353797-166353819 GGAAGGGGGGGAAAGAAGGAAGG - Intergenic
1019354229 7:570547-570569 GGACGGCGGGGGATGAGGGAGGG - Intronic
1019392466 7:796110-796132 GGCTGGAGGGGAAACAGGGACGG + Intergenic
1019730591 7:2627427-2627449 GGAAAGAGGGGAAAGAAGGAAGG + Intergenic
1020093868 7:5356827-5356849 GGGCGGGGGGGGAAGGAGGACGG + Intronic
1020173815 7:5866404-5866426 GGAAGGGGGGGAGAGAAGGAGGG + Intergenic
1020748641 7:12111657-12111679 CGCCCGCGGGGAAAGGAGGAGGG + Intergenic
1021503689 7:21357280-21357302 GGAAGGAAGGGAAAGAAGGAGGG + Intergenic
1021719498 7:23491764-23491786 GGAAGGCAGGGAGAGAAGGAGGG - Intergenic
1023249136 7:38238778-38238800 GGCTGGAGGGGAGAGAGGGAGGG - Intergenic
1023403916 7:39811810-39811832 GGCAGGGAGGGAGAGAAGGAGGG + Intergenic
1024284687 7:47746992-47747014 TGCAGGCAGGGAAAGAAGGCTGG - Intronic
1024542674 7:50491809-50491831 AGCTGGAGGGGAAAGAGGGAGGG - Intronic
1025919384 7:65896562-65896584 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1026077543 7:67186254-67186276 GGGCGGGGGGGAAGAAAGGAAGG - Intronic
1026133359 7:67638047-67638069 GGCCTTTGGGGAGAGAAGGAAGG + Intergenic
1026261429 7:68758952-68758974 GGCAGGGAGGGAAGGAAGGAAGG + Intergenic
1026517677 7:71086911-71086933 GGCTGGCGGAGAAGGGAGGATGG + Intergenic
1026545907 7:71321910-71321932 GGAGGGAGGGGAAGGAAGGAAGG - Intronic
1026662828 7:72317183-72317205 GGCAGGAGGGGAGGGAAGGAGGG + Intronic
1026675371 7:72424017-72424039 GGGAGGAGGGGAAGGAAGGAAGG + Intronic
1026927404 7:74204069-74204091 GGCAGGGAGGGAAGGAAGGAAGG + Intronic
1026927430 7:74204142-74204164 GGCAGGGAGGGAAGGAAGGAAGG + Intronic
1026927439 7:74204166-74204188 GGCAGGGAGGGAAGGAAGGAGGG + Intronic
1027539666 7:79452625-79452647 GGAAGGGAGGGAAAGAAGGAAGG - Intronic
1027571267 7:79870263-79870285 GGCTGGAGCAGAAAGAAGGAGGG + Intergenic
1027971683 7:85091104-85091126 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1029374702 7:100170640-100170662 GGAAGGCAGGGAGAGAAGGAAGG + Intronic
1030238792 7:107296134-107296156 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1030469925 7:109951219-109951241 GGTTGGAGGGGAAAGAGGGAGGG - Intergenic
1030497253 7:110315461-110315483 GGCAGGCAGGAAGAGAAGGAGGG + Intergenic
1030894225 7:115037612-115037634 GGGCAGTGGGGAAAGGAGGAGGG + Intergenic
1031485336 7:122317042-122317064 GGCTGGCGGGATCAGAAGGACGG + Intergenic
1031620198 7:123926258-123926280 GGCCGGCGGGGAAAGAAGGAGGG - Intronic
1031871310 7:127091873-127091895 GGCCGGCGGGGAATGATGAGTGG - Intronic
1032154654 7:129458194-129458216 TGCTGGAGGGGAAAGAAGGGAGG - Exonic
1032297626 7:130655564-130655586 GAGGGGCGGGGAGAGAAGGAAGG - Intronic
1033053691 7:138030297-138030319 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1033714532 7:143986023-143986045 AGCCAGAAGGGAAAGAAGGAAGG - Intergenic
1033959419 7:146895280-146895302 GGGCGGGAGGGAAGGAAGGAAGG - Intronic
1034427223 7:151020361-151020383 GGGAGGAGGGGAAAGAAGGGAGG + Intronic
1034713846 7:153220993-153221015 GGCTGGAGAGGAAAGAGGGAGGG - Intergenic
1035143299 7:156786149-156786171 GGCCGGGAGGGAAGGAAGGAAGG + Intronic
1035445960 7:158943486-158943508 GGCCGAGGGGGCAGGAAGGATGG + Intronic
1035765247 8:2100176-2100198 GGCAGGGAGGGAAGGAAGGAAGG - Intronic
1036192201 8:6680649-6680671 GGACGGGAGGGAAGGAAGGAAGG - Intergenic
1036604153 8:10291746-10291768 GGCTGGCAGGGAAAGGATGAGGG + Intronic
1036658801 8:10694473-10694495 GGCTGGAGGGGAAAGAAGGAGGG + Intronic
1036744825 8:11399192-11399214 GGCAGGGGTGGACAGAAGGATGG + Intronic
1037203327 8:16284539-16284561 GGCAGTCGGGGAAAGAGGAAAGG - Intronic
1037743906 8:21628439-21628461 GGCTGGGGGAGAAGGAAGGAAGG + Intergenic
1039314543 8:36356755-36356777 GGCAGGGAGGGAAGGAAGGAAGG + Intergenic
1039428491 8:37506372-37506394 GGAAGGGAGGGAAAGAAGGAAGG + Intergenic
1039428496 8:37506389-37506411 GGAAGGGAGGGAAAGAAGGAAGG + Intergenic
1039428512 8:37506457-37506479 GGAAGGGAGGGAAAGAAGGAAGG + Intergenic
1039476510 8:37841794-37841816 GGCCGGCGGGGAAGGAGAGCCGG + Exonic
1039493854 8:37966486-37966508 GGGCGGTAGGGAAAGAAGGAAGG + Exonic
1039516532 8:38138315-38138337 GGCTGGAGGGGAAAGTAGGAGGG + Intronic
1040509762 8:48083880-48083902 GGCCTGCGTGGAACGCAGGAGGG + Intergenic
1041343351 8:56869383-56869405 GGAAGGCAGGGAAAGAAGAATGG + Intergenic
1041378817 8:57230205-57230227 GGTCAGGGAGGAAAGAAGGAGGG + Intergenic
1041796890 8:61754332-61754354 GGGAGGAGGGGAAAGAAGGAAGG - Intergenic
1042421075 8:68589920-68589942 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1043499085 8:80835465-80835487 GGCTGGAGGGGAGAGAAGGAGGG + Intronic
1044185497 8:89245933-89245955 GGAAGGCGGGGAAGGAAGAAAGG - Intergenic
1045379563 8:101609806-101609828 GGTTGGCTGGGAAACAAGGAAGG + Intronic
1045755296 8:105534266-105534288 GGGAGGGAGGGAAAGAAGGAAGG - Intronic
1046160118 8:110351538-110351560 GGCAGGCAGGGAAGGAGGGAGGG - Intergenic
1046630380 8:116617494-116617516 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1047059521 8:121209051-121209073 GGAGGGAGGGGAAGGAAGGAGGG - Intergenic
1047066671 8:121291916-121291938 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1047511881 8:125521757-125521779 GGCTGGAAGGAAAAGAAGGAAGG - Intergenic
1047821417 8:128525390-128525412 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1047827873 8:128597477-128597499 GGCCTGAGGAGAGAGAAGGAGGG - Intergenic
1048077250 8:131084943-131084965 GGCTGGAGGAGAAAGAAGGAGGG + Intergenic
1048529432 8:135234130-135234152 GGCTTGGGGGGAGAGAAGGAAGG - Intergenic
1049617422 8:143581736-143581758 GCCCAGTGGGGGAAGAAGGAAGG + Intronic
1049685830 8:143938985-143939007 GGCCGGGGGGGACTGCAGGACGG - Intronic
1050258859 9:3820118-3820140 GGGCTGTGGGGAAAGAAGAATGG - Intergenic
1050442022 9:5674746-5674768 GGCTGGAGGGGAGAGAAGGAGGG - Intronic
1051681418 9:19611474-19611496 GGCGGGAGGGGAAAGGCGGAAGG + Intronic
1052445935 9:28561083-28561105 GGCAAGTGAGGAAAGAAGGAGGG + Intronic
1053129718 9:35608140-35608162 GTCCTGTGGGGACAGAAGGAGGG - Exonic
1053346189 9:37380077-37380099 GGAGGGCAGGGAGAGAAGGAAGG + Intergenic
1055573565 9:77641091-77641113 GGAGGGGGGGGAAGGAAGGAAGG + Intronic
1055824483 9:80307097-80307119 GGAAGGAGGGGAAGGAAGGAAGG - Intergenic
1056288232 9:85113071-85113093 GGCTGGAGGAGAAAGAGGGAGGG + Intergenic
1056778228 9:89529850-89529872 GGCTAGCGGGGAGAGGAGGATGG - Intergenic
1056827883 9:89889480-89889502 GGCTGGAGGGGAAGGAGGGAGGG + Intergenic
1056998133 9:91483211-91483233 GGACGGGAGGGACAGAAGGAGGG - Intergenic
1057006313 9:91563727-91563749 GGCAGGAAGGGAAGGAAGGAAGG + Intronic
1057292872 9:93818418-93818440 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
1057705013 9:97389857-97389879 GTGCAGAGGGGAAAGAAGGAAGG + Intergenic
1059234472 9:112750642-112750664 GGCACGTGGGGAAGGAAGGACGG - Intergenic
1059701030 9:116775595-116775617 GGGAGGGAGGGAAAGAAGGAAGG + Intronic
1059750656 9:117244548-117244570 GGACAGTGGGGAAGGAAGGAAGG + Intronic
1061142322 9:128775067-128775089 GGAAGGAAGGGAAAGAAGGAAGG + Intergenic
1061202602 9:129146308-129146330 GGAGGGGAGGGAAAGAAGGATGG - Intronic
1061245805 9:129400849-129400871 GGCTGCCGAGGAACGAAGGAGGG + Intergenic
1061435736 9:130560572-130560594 TGCCAGCAGGAAAAGAAGGAGGG + Intergenic
1061542127 9:131283074-131283096 CGCCGCCGGGGAAGGACGGAGGG + Intergenic
1061777924 9:132978130-132978152 GGGAGGCAGGGAAAAAAGGAGGG + Intronic
1061789681 9:133052389-133052411 GGACAGGGGGGAAGGAAGGATGG - Intronic
1062467346 9:136687078-136687100 GACGGGCGGGGCAGGAAGGAGGG + Intronic
1062649589 9:137568709-137568731 AGCAGGAGGGGAAAGACGGACGG + Intronic
1203470182 Un_GL000220v1:112683-112705 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1203478003 Un_GL000220v1:156655-156677 TGCCGGCGGGGAGAGAGGGTCGG + Intergenic
1203626608 Un_KI270750v1:31833-31855 GGCCGCCGGGAAAAGAAGGTAGG - Intergenic
1185459890 X:328987-329009 GGGGGGCGGGGAGAGAGGGAGGG - Intergenic
1185492528 X:528761-528783 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1185659967 X:1719865-1719887 GGAAGGAAGGGAAAGAAGGAAGG - Intergenic
1185659975 X:1719903-1719925 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1185659992 X:1719974-1719996 GGAGGGAAGGGAAAGAAGGAAGG - Intergenic
1186246666 X:7622638-7622660 GGCAGGAAGGGAGAGAAGGAGGG - Intergenic
1187149391 X:16668233-16668255 GGCTGGGTGAGAAAGAAGGAAGG + Intronic
1187505323 X:19874485-19874507 GGCAGGAGGGGGAAGAAGAAAGG + Intronic
1188120080 X:26294283-26294305 GACTGGAGGGGAAAGAGGGAGGG - Intergenic
1188322231 X:28753890-28753912 GGCTGGCAGGGAGGGAAGGAAGG + Intronic
1188322233 X:28753894-28753916 GGCAGGGAGGGAAGGAAGGAGGG + Intronic
1188478278 X:30610598-30610620 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1188505986 X:30885576-30885598 GACCAACTGGGAAAGAAGGATGG + Intronic
1188880953 X:35491648-35491670 GGACGAGGGAGAAAGAAGGAAGG - Intergenic
1189864208 X:45307397-45307419 GGCTGGAGGGGAAAGAAGGAAGG - Intergenic
1190101584 X:47526357-47526379 GGGAGGGAGGGAAAGAAGGAAGG - Intergenic
1190215377 X:48476462-48476484 CGCCTGCGGGGAAAGGAGGGAGG + Intronic
1190273426 X:48884696-48884718 GGCTGGCGGGGAAAGAGGGAGGG + Intergenic
1190465695 X:50723348-50723370 GGCAGGGAGGGAAGGAAGGAGGG + Intronic
1192070198 X:67930836-67930858 GGTTGGCGGGGAAACGAGGAAGG + Intergenic
1192216826 X:69165012-69165034 GGCCGAGGAGGGAAGAAGGAAGG + Intronic
1192447769 X:71223445-71223467 GGCTGGCGGGAAAAGAATGTTGG + Intronic
1195112226 X:101659591-101659613 GGGCGGTGGGGAAAGGGGGAGGG - Intronic
1195966653 X:110435123-110435145 GGAGGGAGGGGGAAGAAGGAGGG + Intronic
1196196256 X:112840934-112840956 AGAGGGCGGGGAAAGAAGGGCGG + Intergenic
1196207207 X:112954592-112954614 GGGCAGGAGGGAAAGAAGGAAGG - Intergenic
1197215076 X:123859920-123859942 GGCGGAGGGGGGAAGAAGGAGGG + Intronic
1198323429 X:135542545-135542567 GGAGGGAGGGGAAGGAAGGAAGG + Intronic
1199827262 X:151512817-151512839 GGCTGGAGGGGAAAGAGGTAGGG + Intergenic
1201451153 Y:14116210-14116232 GAGGGGAGGGGAAAGAAGGAGGG + Intergenic
1201480429 Y:14432739-14432761 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic
1201517653 Y:14835375-14835397 GGAAGGGAGGGAAAGAAGGAAGG + Intronic
1201736264 Y:17265259-17265281 GGAGGGAGGGGAAGGAAGGAAGG + Intergenic