ID: 1031626626

View in Genome Browser
Species Human (GRCh38)
Location 7:123999753-123999775
Sequence TCTGATATGCAGAATCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031626622_1031626626 24 Left 1031626622 7:123999706-123999728 CCTATAGAATGGTAGAAAATATT 0: 12
1: 382
2: 4408
3: 16367
4: 18362
Right 1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG No data
1031626624_1031626626 -5 Left 1031626624 7:123999735-123999757 CCATGCACCTTAAAAAGGTCTGA No data
Right 1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031626626 Original CRISPR TCTGATATGCAGAATCTATA AGG Intergenic
No off target data available for this crispr