ID: 1031626626 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:123999753-123999775 |
Sequence | TCTGATATGCAGAATCTATA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1031626622_1031626626 | 24 | Left | 1031626622 | 7:123999706-123999728 | CCTATAGAATGGTAGAAAATATT | 0: 12 1: 382 2: 4408 3: 16367 4: 18362 |
||
Right | 1031626626 | 7:123999753-123999775 | TCTGATATGCAGAATCTATAAGG | No data | ||||
1031626624_1031626626 | -5 | Left | 1031626624 | 7:123999735-123999757 | CCATGCACCTTAAAAAGGTCTGA | No data | ||
Right | 1031626626 | 7:123999753-123999775 | TCTGATATGCAGAATCTATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1031626626 | Original CRISPR | TCTGATATGCAGAATCTATA AGG | Intergenic | ||
No off target data available for this crispr |