ID: 1031627216

View in Genome Browser
Species Human (GRCh38)
Location 7:124004961-124004983
Sequence CTGAGTTAACCTGGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031627216_1031627222 0 Left 1031627216 7:124004961-124004983 CCTTCCACCCCAGGTTAACTCAG No data
Right 1031627222 7:124004984-124005006 ACACTCCAAAGCCTAAAGGTTGG No data
1031627216_1031627224 5 Left 1031627216 7:124004961-124004983 CCTTCCACCCCAGGTTAACTCAG No data
Right 1031627224 7:124004989-124005011 CCAAAGCCTAAAGGTTGGAATGG No data
1031627216_1031627221 -4 Left 1031627216 7:124004961-124004983 CCTTCCACCCCAGGTTAACTCAG No data
Right 1031627221 7:124004980-124005002 TCAGACACTCCAAAGCCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031627216 Original CRISPR CTGAGTTAACCTGGGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr