ID: 1031627245

View in Genome Browser
Species Human (GRCh38)
Location 7:124005088-124005110
Sequence TGTCAGTTAGAGAGCTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031627242_1031627245 -3 Left 1031627242 7:124005068-124005090 CCAGGGGGAATTCAGATCTCTGT No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627232_1031627245 24 Left 1031627232 7:124005041-124005063 CCCACCCCTCTGTCTGGGAGTGC No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627236_1031627245 18 Left 1031627236 7:124005047-124005069 CCTCTGTCTGGGAGTGCTGTCCC No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627234_1031627245 20 Left 1031627234 7:124005045-124005067 CCCCTCTGTCTGGGAGTGCTGTC No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627241_1031627245 -2 Left 1031627241 7:124005067-124005089 CCCAGGGGGAATTCAGATCTCTG No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627233_1031627245 23 Left 1031627233 7:124005042-124005064 CCACCCCTCTGTCTGGGAGTGCT No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data
1031627235_1031627245 19 Left 1031627235 7:124005046-124005068 CCCTCTGTCTGGGAGTGCTGTCC No data
Right 1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031627245 Original CRISPR TGTCAGTTAGAGAGCTTGGG TGG Intergenic
No off target data available for this crispr