ID: 1031628304

View in Genome Browser
Species Human (GRCh38)
Location 7:124015997-124016019
Sequence TAAGGTACACCAGTGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031628301_1031628304 22 Left 1031628301 7:124015952-124015974 CCATGTGATGAAGAAGGCAGAGA No data
Right 1031628304 7:124015997-124016019 TAAGGTACACCAGTGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031628304 Original CRISPR TAAGGTACACCAGTGATTGC TGG Intergenic
No off target data available for this crispr