ID: 1031636932

View in Genome Browser
Species Human (GRCh38)
Location 7:124112793-124112815
Sequence TAAGATCCTGAAGATAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031636932_1031636934 -2 Left 1031636932 7:124112793-124112815 CCAAGCCTATCTTCAGGATCTTA No data
Right 1031636934 7:124112814-124112836 TAACCCTGCCTTTGTGCTTTAGG No data
1031636932_1031636938 2 Left 1031636932 7:124112793-124112815 CCAAGCCTATCTTCAGGATCTTA No data
Right 1031636938 7:124112818-124112840 CCTGCCTTTGTGCTTTAGGAGGG No data
1031636932_1031636936 1 Left 1031636932 7:124112793-124112815 CCAAGCCTATCTTCAGGATCTTA No data
Right 1031636936 7:124112817-124112839 CCCTGCCTTTGTGCTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031636932 Original CRISPR TAAGATCCTGAAGATAGGCT TGG (reversed) Intergenic
No off target data available for this crispr