ID: 1031636936

View in Genome Browser
Species Human (GRCh38)
Location 7:124112817-124112839
Sequence CCCTGCCTTTGTGCTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031636933_1031636936 -4 Left 1031636933 7:124112798-124112820 CCTATCTTCAGGATCTTAACCCT No data
Right 1031636936 7:124112817-124112839 CCCTGCCTTTGTGCTTTAGGAGG No data
1031636932_1031636936 1 Left 1031636932 7:124112793-124112815 CCAAGCCTATCTTCAGGATCTTA No data
Right 1031636936 7:124112817-124112839 CCCTGCCTTTGTGCTTTAGGAGG No data
1031636931_1031636936 2 Left 1031636931 7:124112792-124112814 CCCAAGCCTATCTTCAGGATCTT No data
Right 1031636936 7:124112817-124112839 CCCTGCCTTTGTGCTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031636936 Original CRISPR CCCTGCCTTTGTGCTTTAGG AGG Intergenic
No off target data available for this crispr