ID: 1031644448

View in Genome Browser
Species Human (GRCh38)
Location 7:124206561-124206583
Sequence ATGTATACAGAGAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031644448_1031644451 15 Left 1031644448 7:124206561-124206583 CCTTGTTCCTTCTCTGTATACAT No data
Right 1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031644448 Original CRISPR ATGTATACAGAGAAGGAACA AGG (reversed) Intergenic
No off target data available for this crispr