ID: 1031644451

View in Genome Browser
Species Human (GRCh38)
Location 7:124206599-124206621
Sequence GCCTGACTTACTCCACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031644447_1031644451 28 Left 1031644447 7:124206548-124206570 CCTTAACTTTTCTCCTTGTTCCT No data
Right 1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG No data
1031644449_1031644451 8 Left 1031644449 7:124206568-124206590 CCTTCTCTGTATACATCTAAATC No data
Right 1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG No data
1031644446_1031644451 29 Left 1031644446 7:124206547-124206569 CCCTTAACTTTTCTCCTTGTTCC No data
Right 1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG No data
1031644448_1031644451 15 Left 1031644448 7:124206561-124206583 CCTTGTTCCTTCTCTGTATACAT No data
Right 1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031644451 Original CRISPR GCCTGACTTACTCCACAGAA AGG Intergenic
No off target data available for this crispr