ID: 1031645449

View in Genome Browser
Species Human (GRCh38)
Location 7:124220486-124220508
Sequence CATGAGAGGGACCCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031645436_1031645449 26 Left 1031645436 7:124220437-124220459 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645441_1031645449 -5 Left 1031645441 7:124220468-124220490 CCCATAATCCCCATGTGTCATGA 0: 42
1: 535
2: 1400
3: 2689
4: 4167
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645442_1031645449 -6 Left 1031645442 7:124220469-124220491 CCATAATCCCCATGTGTCATGAG 0: 38
1: 520
2: 1401
3: 2689
4: 4142
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645437_1031645449 25 Left 1031645437 7:124220438-124220460 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645440_1031645449 20 Left 1031645440 7:124220443-124220465 CCAAATCTCATCTTGAATTATGA 0: 3
1: 405
2: 4132
3: 14312
4: 15080
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645439_1031645449 21 Left 1031645439 7:124220442-124220464 CCCAAATCTCATCTTGAATTATG 0: 19
1: 1054
2: 9078
3: 12413
4: 10032
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data
1031645438_1031645449 24 Left 1031645438 7:124220439-124220461 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1031645449 7:124220486-124220508 CATGAGAGGGACCCAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031645449 Original CRISPR CATGAGAGGGACCCAGTGGA AGG Intergenic
No off target data available for this crispr