ID: 1031645626

View in Genome Browser
Species Human (GRCh38)
Location 7:124221878-124221900
Sequence CCGTGAAAGCCCCTGGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031645619_1031645626 8 Left 1031645619 7:124221847-124221869 CCTGAAGAAGCTACAGACACTCA No data
Right 1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG No data
1031645618_1031645626 21 Left 1031645618 7:124221834-124221856 CCTGCATTATGTGCCTGAAGAAG No data
Right 1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031645626 Original CRISPR CCGTGAAAGCCCCTGGGATG GGG Intergenic
No off target data available for this crispr