ID: 1031646488

View in Genome Browser
Species Human (GRCh38)
Location 7:124232211-124232233
Sequence TCTCTCATACTGATGTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031646487_1031646488 0 Left 1031646487 7:124232188-124232210 CCAACTCAAATAGTGTCTCAAAA No data
Right 1031646488 7:124232211-124232233 TCTCTCATACTGATGTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031646488 Original CRISPR TCTCTCATACTGATGTTTAT TGG Intergenic
No off target data available for this crispr