ID: 1031646912

View in Genome Browser
Species Human (GRCh38)
Location 7:124237235-124237257
Sequence TCTCTCATACTGATGTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031646911_1031646912 0 Left 1031646911 7:124237212-124237234 CCAACTCAAATAGTGTCTCAAAA No data
Right 1031646912 7:124237235-124237257 TCTCTCATACTGATGTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031646912 Original CRISPR TCTCTCATACTGATGTTTAT TGG Intergenic
No off target data available for this crispr