ID: 1031647329

View in Genome Browser
Species Human (GRCh38)
Location 7:124242208-124242230
Sequence TTTTGAGACACTATTTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031647329_1031647330 0 Left 1031647329 7:124242208-124242230 CCAACTCAAATAGTGTCTCAAAA No data
Right 1031647330 7:124242231-124242253 TCTCTCATACTGATGTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031647329 Original CRISPR TTTTGAGACACTATTTGAGT TGG (reversed) Intergenic
No off target data available for this crispr